Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13909

Pfkp phosphofructokinase, platelet ( MGI:1891833)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13909 EMAGE:13909 EMAGE:13909 EMAGE:13909 EMAGE:13909
"Pseudo-wholemount" of euxassay_007779. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007779_01 euxassay_007779_02 euxassay_007779_03 euxassay_007779_04
EMAGE:13909 EMAGE:13909 EMAGE:13909 EMAGE:13909 EMAGE:13909
euxassay_007779_05 euxassay_007779_06 euxassay_007779_07 euxassay_007779_08 euxassay_007779_09
EMAGE:13909 EMAGE:13909 EMAGE:13909 EMAGE:13909 EMAGE:13909
euxassay_007779_10 euxassay_007779_11 euxassay_007779_12 euxassay_007779_13 euxassay_007779_14
EMAGE:13909 EMAGE:13909 EMAGE:13909 EMAGE:13909 EMAGE:13909
euxassay_007779_15 euxassay_007779_16 euxassay_007779_17 euxassay_007779_18 euxassay_007779_19
EMAGE:13909 EMAGE:13909 EMAGE:13909 EMAGE:13909 EMAGE:13909
euxassay_007779_20 euxassay_007779_21 euxassay_007779_22 euxassay_007779_23 euxassay_007779_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13909Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13909_wholemount_strong.wlz
13909_wholemount_moderate.wlz
13909_wholemount_weak.wlz
13909_wholemount_possible.wlz
13909_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13909_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
brain
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
vibrissa
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 20 21 22 23
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 19 20 21 22
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 07 18
trigeminal v ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 17 18 19 20 21 22
vagus x ganglion
strong strong
regionalstrong expression: see section 08 16
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 07 08 17 18
trigeminal v nerve
strong strong
regionalstrong expression: see section 09 10 17
spinal cord
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 09 10 14 15
cervical ganglion
strong strong
regionalstrong expression: see section 08 09 17
thoracic ganglion
strong strong
regionalstrong expression: see section 10 11 12 13 14
dorsal root ganglion
strong strong
regionalstrong expression: see section 07 08 09 10 14 15 16 17 18
neural retina
strong strong
regionalstrong expression: see section 01 02 03 04 22 23 24
anterior naris epithelium
strong strong
regionalstrong expression: see section 12 13 14 15
external naris epithelium
strong strong
regionalstrong expression: see section 11 16
aorta
strong strong
regionalstrong expression: see section 09 10 11 12 13
heart atrium
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
heart ventricle
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
stomach
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11
midgut
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17 18 19 20 21
lower jaw incisor
strong strong
regionalstrong expression: see section 11 12 13 15 16
lower jaw molar
strong strong
regionalstrong expression: see section 07 19
upper jaw incisor
strong strong
regionalstrong expression: see section 11 12 15 16
upper jaw molar
strong strong
regionalstrong expression: see section 07 19
axial skeleton
strong strong
regionalstrong expression: see section 11 12 13
axial skeleton tail region
strong strong
regionalstrong expression: see section 13 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1348
Entity Detected:Pfkp, phosphofructokinase, platelet ( MGI:1891833)
Sequence:sense strand is shown

>T1348
CCTCGAGNCTGTTGGCCTACTGGAGTGCTTGCTGAGTACGGGAGTGTCTGGCGTCTCTACCTCCTCATCA
TGAGTGACTTGGATTCTTCGAGCTCCAGCGCCTATCCGAAGTACCTGGAGCACCTCTCTGGGGATGGCAA
AGCTATCGGTGTCCTGACCAGCGGCGGGGATGCCCAAGGCATGAATGCTGCTGTCCGCGCTGTGGTGCGC
ATGGGAATCTACACGGGGGCCAAAGTGTACTTTATATATGAGGGTTACCAAGGCTTGGTGGATGGAGGCT
CCAATATTGTGGAAGCCAAATGGGACTGTGTCTCCAGCATTCTGCAAGTGGGTGGGACCATCATCGGTAG
TGCGCGCTGCAAAGCCTTTCGAAGCCGTGAAGGGCGCCTGAAAGCTGCCTGTAACTTGGCGCGCTTGGGC
ATAACCAATCTGTGCGTGATCGGCGGGGACGGAAGTCTCACGGGAGCCAACCTCTTCCGAAAGGAGTGGA
GCGGACTTCTGGAAGAGCTGGCTCGGAATGGTGATATCGATAACGACACAGTGCAGAAGTATTCCTACCT
CAAC
Notes:The probe template was PCR amplified from IMAGE:2301044 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2301044 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13910 same embryo
 EMAGE:13908 same embryo
 EMAGE:13907 same embryo
 EMAGE:13904 same embryo
 EMAGE:13905 same embryo
 EMAGE:13906 same embryo
 EurExpress:euxassay_007779 same experiment
 MGI:4827166 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS