Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:14220

Pdgfa platelet derived growth factor, alpha ( MGI:97527)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:14220 EMAGE:14220 EMAGE:14220 EMAGE:14220 EMAGE:14220
"Pseudo-wholemount" of euxassay_004036. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_004036_01 euxassay_004036_02 euxassay_004036_03 euxassay_004036_04
EMAGE:14220 EMAGE:14220 EMAGE:14220 EMAGE:14220 EMAGE:14220
euxassay_004036_05 euxassay_004036_06 euxassay_004036_07 euxassay_004036_08 euxassay_004036_09
EMAGE:14220 EMAGE:14220 EMAGE:14220 EMAGE:14220 EMAGE:14220
euxassay_004036_10 euxassay_004036_11 euxassay_004036_12 euxassay_004036_13 euxassay_004036_14
EMAGE:14220 EMAGE:14220 EMAGE:14220 EMAGE:14220 EMAGE:14220
euxassay_004036_15 euxassay_004036_16 euxassay_004036_17 euxassay_004036_18 euxassay_004036_19
EMAGE:14220 EMAGE:14220
euxassay_004036_20 euxassay_004036_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:14220Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
14220_wholemount_strong.wlz
14220_wholemount_moderate.wlz
14220_wholemount_weak.wlz
14220_wholemount_possible.wlz
14220_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:14220_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 19 20 21
upper leg muscle
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 18 19 20
diaphragm
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 11 12 15 16 17 18 19 20 21 weak expression: see section 10 14
forearm rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04
hand
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 21
foot
moderate moderate
regionalmoderate expression: see section 11 12 13 14
lower leg rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 21
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
thymus primordium
moderate moderate
regionalmoderate expression: see section 10 11 13 14
submandibular gland primordium
strong strong
regionalstrong expression: see section 07 08 09 10 17 18 19 20
epidermis
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
vibrissa
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 20 moderate expression: see section 21
diencephalon roof plate
moderate moderate
regionalmoderate expression: see section 13 14
choroid invagination
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 15 16 17 18
metencephalon part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 01 moderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 01 02 03 04 05 20 21 moderate expression: see section 17 18 19
conjunctival sac
strong strong
regionalstrong expression: see section 02 03 04 05 moderate expression: see section 01 20 21
eye skeletal muscle
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 20
anterior naris
strong strong
regionalstrong expression: see section 13 14 15 16 17 18
external naris
strong strong
regionalstrong expression: see section 13 18
posterior naris
strong strong
regionalstrong expression: see section 13 16 17
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 10 11 12 13 15 16 17 18 19 20
naso-lacrimal duct
strong strong
regionalstrong expression: see section 08 09 10 19 20 moderate expression: see section 11 12 weak expression: see section 21
vomeronasal organ
strong strong
regionalstrong expression: see section 13
esophagus epithelium
moderate moderate
regionalmoderate expression: see section 10 11 12
pharynx epithelium
moderate moderate
regionalmoderate expression: see section 13
tongue epithelium
strong strong
regionalstrong expression: see section 11 12 13 14 17 18 moderate expression: see section 15 16
tongue muscle
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17 18
stomach
moderate moderate
regionalmoderate expression: see section 01 02 03 weak expression: see section 04 05 06 07 08 09
midgut
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18 19 weak expression: see section 09
lower jaw incisor
strong strong
regionalstrong expression: see section 11 12 13 16 17 18
lower jaw molar
strong strong
regionalstrong expression: see section 08 09 19
oral epithelium
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
upper jaw incisor
strong strong
regionalstrong expression: see section 13 14 18
upper jaw molar
strong strong
regionalstrong expression: see section 08 17 20
kidney calyx
moderate moderate
regionalmoderate expression: see section 04 05 06 07 13 14 15 16 18
seminiferous cord
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 16 17 18
urethra of male
strong strong
regionalstrong expression: see section 13 14 15
left lung
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10
right lung
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17 18 19 20
trachea
moderate moderate
regionalmoderate expression: see section 12
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 21
tail paraxial mesenchyme
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17 18 19 20 21
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18 19 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T6141
Entity Detected:Pdgfa, platelet derived growth factor, alpha ( MGI:97527)
Sequence:sense strand is shown

>T6141
GCTGGCTTTGCACTCGCTGCTCGCGCCGAGCGCGCTCCGCAGGCTCCCTGCTCTCCGCGCCACCCTCCTC
CGGGCCGCGCTCCCTGAGGGATGGTACTGAATTTCGCCGCCACAGGAGCCCGGCTGGAGCGCCCGCCCCG
CGGCCTCGCCTCCCTGCCGAGCTTCCAGCGCCTCGGGACGCGATGAGGACCTGGGCTTGCCTGCTGCTCC
TCGGCTGCGGATACCTCGCCCATGCCCTGGCCGAGGAAGCCGAGATACCCCGGGAGTTGATCGAGCGGCT
GGCTCGAAGTCAGATCCACAGCATCCGGGACCTCCAGCGACTCTTGGAGATAGACTCCGTAGGGGCTGAG
GATGCCTTGGAGACAAGCCTGAGAGCCCATGGGTCCCATGCCATTAACCATGTGCCCGAGAAGCGGCCTG
TGCCCATTCGCAGGAAGAGAAGTATTGAGGAAGCCATTCCCGCAGTTTGCAAGACCAGGACGGTCATTTA
CGAGATACCTCGGAGCCAGGTGGACCCCACATCGGCCAACTTCCTGATCTGGCCCCCATGTGTGGAGGTG
AAGCGCTGCACTGGCTGTTGTAACACCAGCAGCGTCAAGTGCCAGCCTTCACGGGTCCACCACCGCAGTG
TCAAGGTGGCCAAAGTGGAGTATGTCAGGAAGAAGCCAAAATTGAAAGAGGTCCAGGTGAGGTTAGAGGA
ACACCTGGAGTGTGCATGTGCGACCTCCAACCTGAACCCAGACCATCGGGAGGAGGAGACAGATGTGAGG
TGAGATGAGCCGGCCGCCCTCTCCCGGGACACGGATGTGCGTGGCGTGTGACATTCCTGAACATACTATG
TATGGTGCTTCATTGCCAATGTGCGTGCGGTCTTTGTTCTCCTCCGTGAAAAACTGTGTCCGAGGACAAA
GAGACAGTGTCCGTTTGTTCAGTGTGACATCAAAGCAAGTACTGTAGCACTCAGAGAGACAGTGAGAAAG
CTTCCTTGTCACAGAGAGCGAAAACAAAACCACAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:3495629 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:3495629 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:14222 same embryo
 EMAGE:14223 same embryo
 EMAGE:14221 same embryo
 EMAGE:14219 same embryo
 EurExpress:euxassay_004036 same experiment
 MGI:4827125 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS