Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:14700

Gad1 glutamic acid decarboxylase 1 ( MGI:95632)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:14700 EMAGE:14700 EMAGE:14700 EMAGE:14700 EMAGE:14700
"Pseudo-wholemount" of euxassay_005634. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_005634_01 euxassay_005634_02 euxassay_005634_03 euxassay_005634_04
EMAGE:14700 EMAGE:14700 EMAGE:14700 EMAGE:14700 EMAGE:14700
euxassay_005634_05 euxassay_005634_06 euxassay_005634_07 euxassay_005634_08 euxassay_005634_09
EMAGE:14700 EMAGE:14700 EMAGE:14700 EMAGE:14700 EMAGE:14700
euxassay_005634_10 euxassay_005634_11 euxassay_005634_12 euxassay_005634_13 euxassay_005634_14
EMAGE:14700 EMAGE:14700 EMAGE:14700 EMAGE:14700 EMAGE:14700
euxassay_005634_15 euxassay_005634_16 euxassay_005634_17 euxassay_005634_18 euxassay_005634_19
EMAGE:14700 EMAGE:14700 EMAGE:14700
euxassay_005634_20 euxassay_005634_21 euxassay_005634_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:14700Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
14700_wholemount_strong.wlz
14700_wholemount_moderate.wlz
14700_wholemount_weak.wlz
14700_wholemount_possible.wlz
14700_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:14700_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
oral region
strong strong
regionalstrong expression: see section 09 10 13
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
telencephalon
strong strong
regionalstrong expression: see section 02 14
cerebral cortex
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 15 16 17 18 19 20 21 22
corpus striatum
strong strong
regionalstrong expression: see section 04 05 06 07 08 18 19 20 21 22 not examined expression: see section 17
telencephalon mantle layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 11 12 13 14 15 16 17 18 19 20 21 22
telencephalon marginal layer
strong strong
regionalstrong expression: see section 10
olfactory lobe
strong strong
regionalstrong expression: see section 09 10 11 14 15 16 17 not examined expression: see section 18
hindbrain
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
midbrain mantle layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
spinal cord
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14
lower jaw incisor
strong strong
regionalstrong expression: see section 08 09 12 13
lower jaw molar
strong strong
regionalstrong expression: see section 05 17
upper jaw incisor
strong strong
regionalstrong expression: see section 08 09 12 13
upper jaw molar
strong strong
regionalstrong expression: see section 05 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3752
Entity Detected:Gad1, glutamic acid decarboxylase 1 ( MGI:95632)
Sequence:sense strand is shown

>T3752
TGGCCTCGAGCCAGATTCGGACGAGGACCAGGGATCGTGCAAGCAAGGAAGCAGCCCTGGGGTGACACCC
AGCACGTACTCCTGTGACAGAGCCGAGCCCAGCCCAGCCCCGGGACGCTTCGCAGAGGAGTCGCGGGAGG
GTCCAGCTCGCTGTCGCTGAACCGAGCCTGTTCCTGCGCCCAGTCTGCGGGGGACCCTTGAACCGTAGAG
ACCCCAAGACCACCGAGCTGATGGCATCTTCCACTCCTTCGCCTGCAACCTCCTCGAACGCGGGAGCGGA
TCCTAATACTACCAACCTGCGCCCTACAACGTATGATACTTGGTGTGGCGTAGCCCATGGATGCACCAGA
AAACTGGGCCTGAAGATCTGTGGCTTCTTACAAAGGACCAATAGCCTGGAAGAGAAGAGTCGTCTTGTGA
GCGCCTTCAGGGAGAGGCAGTCCTCCAAGAACCTGCTTTCCTGTGAAAACAGTGACCAGGGTGCCCGCTT
CCGGCGCACAGAGACCGACTTCTCCAACCTGTTTGCTCAAGATCTGCTTCCAGCTAAGA
Notes:The probe template was PCR amplified from IMAGE:374236 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:374236 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:14699 same embryo
 EMAGE:14698 same embryo
 EMAGE:14701 same embryo
 EurExpress:euxassay_005634 same experiment
 MGI:4824970 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS