Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:14702

St14 suppression of tumorigenicity 14 (colon carcinoma) ( MGI:1338881)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:14702 EMAGE:14702 EMAGE:14702 EMAGE:14702 EMAGE:14702
"Pseudo-wholemount" of euxassay_005667. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_005667_01 euxassay_005667_02 euxassay_005667_03 euxassay_005667_04
EMAGE:14702 EMAGE:14702 EMAGE:14702 EMAGE:14702 EMAGE:14702
euxassay_005667_05 euxassay_005667_06 euxassay_005667_07 euxassay_005667_08 euxassay_005667_09
EMAGE:14702 EMAGE:14702 EMAGE:14702 EMAGE:14702 EMAGE:14702
euxassay_005667_10 euxassay_005667_11 euxassay_005667_12 euxassay_005667_13 euxassay_005667_14
EMAGE:14702 EMAGE:14702 EMAGE:14702 EMAGE:14702 EMAGE:14702
euxassay_005667_15 euxassay_005667_16 euxassay_005667_17 euxassay_005667_18 euxassay_005667_19
EMAGE:14702 EMAGE:14702 EMAGE:14702 EMAGE:14702 EMAGE:14702
euxassay_005667_20 euxassay_005667_21 euxassay_005667_22 euxassay_005667_23 euxassay_005667_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:14702Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
14702_wholemount_strong.wlz
14702_wholemount_moderate.wlz
14702_wholemount_weak.wlz
14702_wholemount_possible.wlz
14702_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:14702_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 08 09 12 weak expression: see section 11
submandibular gland primordium
strong strong
regionalstrong expression: see section 05 06 07 08 14 16 17 moderate expression: see section 15
pancreas
strong strong
regionalstrong expression: see section 11 12 16 17 moderate expression: see section 15
thyroid gland
moderate moderate
regionalmoderate expression: see section 08 09 12 13
adenohypophysis
weak weak
regionalweak expression: see section 11 12 13 14
vibrissa
strong strong
regionalstrong expression: see section 06 07 08 09 21 22 moderate expression: see section 04 05 20 23
inner ear
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 21 22 23
not examined not examined
regionalnot examined expression: see section 01
cochlea
moderate moderate
regionalmoderate expression: see section 07 08 15 16 17 18 19
utricle
moderate moderate
regionalmoderate expression: see section 16 17 18 19 not examined expression: see section 01
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 15 16 17 18 19 20 21 22 23 24
stomach
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 11 moderate expression: see section 02
rectum
strong strong
regionalstrong expression: see section 16
midgut
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17 18 19
lower jaw incisor
strong strong
regionalstrong expression: see section 14 moderate expression: see section 15
lower jaw molar
strong strong
regionalstrong expression: see section 07 moderate expression: see section 17 18 19
oral epithelium
moderate moderate
regionalmoderate expression: see section 06 07 08 09 11 12 13 14 15 16 17 18 19 20
upper jaw incisor
strong strong
regionalstrong expression: see section 12 moderate expression: see section 15
upper jaw molar
strong strong
regionalstrong expression: see section 07 moderate expression: see section 18 19
bladder
strong strong
regionalstrong expression: see section 14 15
metanephros
strong strong
spottedstrong expression: see section 17 18 moderate expression: see section 07 08 09 11 16 19 20
urethra of male
strong strong
regionalstrong expression: see section 16 17
lung
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 11 12 13 14 15 16 17 18 19 20 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3379
Entity Detected:St14, suppression of tumorigenicity 14 (colon carcinoma) ( MGI:1338881)
Sequence:sense strand is shown

>T3379
TGGCCTCGAGNCAGAATTCGGACGAGGGCTGGCAAGGCCATCTGGGTCACAGGCTGGGGGCACACAAAAG
AGGGAGGTACCGGAGCGCTGATCCTGCAGAAGGGTGAGATCCGTGTCATCAACCAGACCACCTGTGAGGA
CCTCATGCCGCAGCAGATCACCCCACGAATGATGTGTGTGGGTTTCCTCAGTGGGGGTGTGGACTCCTGC
CAGGGTGACTCTGGTGGCCCCTTGTCAAGCGCGGAGAAAGATGGGCGAATGTTCCAGGCTGGTGTGGTGA
GCTGGGGTGAAGGCTGCGCTCAGAGGAACAAGCCAGGCGTGTACACAAGGCTCCCTGTAGTTCGGGACTG
GATCAAAGAGCACACTGGGGTATAGCAGCATGGACAGACAGCCGACCACAAACACCCACAGGGATGCCCG
ACATGCACACCTGGATACAGGAGAGGAACACTGACGACATTTATGCTGTGGCCTCCCCCCCCCAACACAA
CCCAGACTGTGAACTGCATCCTTAGGACTCAGAGTTC
Notes:The probe template was PCR amplified from IMAGE:2938206 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2938206 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:14706 same embryo
 EMAGE:14704 same embryo
 EMAGE:14703 same embryo
 EMAGE:14705 same embryo
 EurExpress:euxassay_005667 same experiment
 MGI:4828463 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS