Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:14705

Igsf9 immunoglobulin superfamily, member 9 ( MGI:2135283)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:14705 EMAGE:14705 EMAGE:14705 EMAGE:14705 EMAGE:14705
"Pseudo-wholemount" of euxassay_005660. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_005660_01 euxassay_005660_02 euxassay_005660_03 euxassay_005660_04
EMAGE:14705 EMAGE:14705 EMAGE:14705 EMAGE:14705 EMAGE:14705
euxassay_005660_05 euxassay_005660_06 euxassay_005660_07 euxassay_005660_08 euxassay_005660_09
EMAGE:14705 EMAGE:14705 EMAGE:14705 EMAGE:14705 EMAGE:14705
euxassay_005660_10 euxassay_005660_11 euxassay_005660_12 euxassay_005660_13 euxassay_005660_14
EMAGE:14705 EMAGE:14705 EMAGE:14705 EMAGE:14705 EMAGE:14705
euxassay_005660_15 euxassay_005660_16 euxassay_005660_17 euxassay_005660_18 euxassay_005660_19
EMAGE:14705 EMAGE:14705 EMAGE:14705
euxassay_005660_20 euxassay_005660_21 euxassay_005660_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:14705Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
14705_wholemount_strong.wlz
14705_wholemount_moderate.wlz
14705_wholemount_weak.wlz
14705_wholemount_possible.wlz
14705_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:14705_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 07 14 15
adenohypophysis
weak weak
regionalweak expression: see section 09 10 11 12 13
vibrissa
moderate moderate
regionalmoderate expression: see section 04 05 06 07 18 19 20 21
saccule
moderate moderate
regionalmoderate expression: see section 03 04 06 07 15 17 18 19 20
utricle
moderate moderate
regionalmoderate expression: see section 03 04 06 07 15 17 18 19 20
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 01 02 03 18 19 20 21 22
naris
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 14 15 16 17 18 not examined expression: see section 13
nasal cavity respiratory epithelium
moderate moderate
regionalmoderate expression: see section 12 13 14 15
naso-lacrimal duct
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 18 19 20 21 22
not examined not examined
regionalnot examined expression: see section 12
esophagus epithelium
moderate moderate
regionalmoderate expression: see section 09
pharynx epithelium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12
tongue epithelium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13
stomach
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09
rectum
moderate moderate
regionalmoderate expression: see section 14
midgut
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14
lower jaw molar
moderate moderate
regionalmoderate expression: see section 06 07 16 17
oral epithelium
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11 14
upper jaw molar
moderate moderate
regionalmoderate expression: see section 06 16 17
bladder
moderate moderate
regionalmoderate expression: see section 12 13
metanephros
moderate moderate
regionalmoderate expression: see section 07 08 weak expression: see section 18
urethra of male
moderate moderate
regionalmoderate expression: see section 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1124
Entity Detected:Igsf9, immunoglobulin superfamily, member 9 ( MGI:2135283)
Sequence:sense strand is shown

>T1124
GTTGGCCTACTGGAGCAGCGTGGAGTTGTGGGGGGAAAGGGGGAAGCGGGAGAGCTCTAGAGAGAAGTGA
AATTACCTGGGGGAGAAGAACTAGGGTAGTTCTGGAAGCGAAGTGGAATTACCGATGGATCTGGTGGCCC
TCCAGACAGGAACAGCTCCCTCGGGTGTTGAGTGAGCTAGGCACCAACTGGAAGAGTGAGAGCTGAAACG
GGTTGCCTGAGGCGGATCAGAACTCAACTGATGCTCTCTGGGATTGCCGGGCAGCGGACATTCCTCCGGC
CCCTCCATCTGGGCTCCTGTGAATAGGAGGGGCCGGGCAAGCAGGCCAGCTGGGCTATGATTTGGTGTCT
CCGTCTGACCGTCCTCAGCCTGATCATCAGCCAGGGGGCTGACGGTCGAAGAAAGCCTGAGGTGGTCTCT
GTGGTGGGCCGGGCTGGGGAGAGTGCAGTGCTGGGCTGTGACTTGCTGCCTCCAGCTGGCCACCCCCCTC
TGCATGTCATCGAGTGGCTGCGCTTTGGATTCCTGCTTCCCATCTTCATCCAGTTCGGCCTCTACTCTC
Notes:The probe template was PCR amplified from IMAGE:2135504 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2135504 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:14706 same embryo
 EMAGE:14704 same embryo
 EMAGE:14703 same embryo
 EMAGE:14702 same embryo
 EurExpress:euxassay_005660 same experiment
 MGI:4825549 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS