Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15192

Slc27a1 solute carrier family 27 (fatty acid transporter), member 1 ( MGI:1347098)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15192 EMAGE:15192 EMAGE:15192 EMAGE:15192 EMAGE:15192
"Pseudo-wholemount" of euxassay_010364. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010364_01 euxassay_010364_02 euxassay_010364_03 euxassay_010364_04
EMAGE:15192 EMAGE:15192 EMAGE:15192 EMAGE:15192 EMAGE:15192
euxassay_010364_05 euxassay_010364_06 euxassay_010364_07 euxassay_010364_08 euxassay_010364_09
EMAGE:15192 EMAGE:15192 EMAGE:15192 EMAGE:15192 EMAGE:15192
euxassay_010364_10 euxassay_010364_11 euxassay_010364_12 euxassay_010364_13 euxassay_010364_14
EMAGE:15192 EMAGE:15192 EMAGE:15192 EMAGE:15192 EMAGE:15192
euxassay_010364_15 euxassay_010364_16 euxassay_010364_17 euxassay_010364_18 euxassay_010364_19
EMAGE:15192 EMAGE:15192 EMAGE:15192 EMAGE:15192 EMAGE:15192
euxassay_010364_20 euxassay_010364_21 euxassay_010364_22 euxassay_010364_23 euxassay_010364_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15192Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15192_wholemount_strong.wlz
15192_wholemount_moderate.wlz
15192_wholemount_weak.wlz
15192_wholemount_possible.wlz
15192_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15192_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
forelimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 21 22 23
forelimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 04 21 22 23
forelimb digit 4 phalanx
moderate moderate
regionalmoderate expression: see section 21 22 23
hindlimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 09 10 11 21 23
hindlimb digit 4 phalanx
moderate moderate
regionalmoderate expression: see section 11 21 23
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 16 17 18 19 20
pancreas
moderate moderate
regionalmoderate expression: see section 09 weak expression: see section 10 11
vibrissa
strong strong
regionalstrong expression: see section 05 06 07 08 09 20 21 22 23 24
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 11 12 13
olfactory cortex ventricular layer
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 15 16 17 18 19 20 21 22 23
medulla oblongata alar plate ventricular layer
strong strong
regionalstrong expression: see section 05 06 08 09 10 11 12 13 14 15 16 17 18
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 07 09 10 11 12 13
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
pons ventricular layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
metencephalon part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 03 04 20
midbrain ventricular layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 weak expression: see section 05 07 20
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 weak expression: see section 17
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 weak expression: see section 05 06 07 08 17 18 19 20 21 22
vagus x ganglion
weak weak
regionalweak expression: see section 07 17
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 16 17 18 19 20 21
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 09 10 11 12
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 15 weak expression: see section 14
ear
moderate moderate
regionalmoderate expression: see section 01 02 03 22 23
heart valve
moderate moderate
regionalmoderate expression: see section 10 13 weak expression: see section 11 12
stomach mesentery
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 12
lower jaw molar
moderate moderate
regionalmoderate expression: see section 08 19
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 12
upper jaw molar
moderate moderate
regionalmoderate expression: see section 08 19 20
ovary
moderate moderate
regionalmoderate expression: see section 05 06 07 17 18 19
tail mesenchyme
strong strong
regionalstrong expression: see section 23
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30252
Entity Detected:Slc27a1, solute carrier family 27 (fatty acid transporter), member 1 ( MGI:1347098)
Sequence:sense strand is shown

>T30252
ACTGCAGCATTGCCAACATGGACGGCAAGGTCGGCTCCTGCGGCTTCAACAGCCGTATCCTCACGCATGT
GTACCCCATCCGTCTGGTCAAGGTCAATGAGGACACGATGGAGCCACTGCGGGACTCCGAGGGCCTCTGC
ATCCCGTGCCAGCCCGGGGAACCCGGCCTTCTCGTGGGCCAGATCAACCAGCAGGACCCTCTGCGGCGTT
TCGATGGTTATGTTAGTGACAGTGCCACCAACAAGAAGATTGCCCACAGCGTTTTCCGAAAGGGCGATAG
CGCCTACCTCTCAGGTGACGTGCTAGTGATGGACGAGCTGGGCTACATGTATTTCCGTGACCGCAGCGGG
GACACCTTCCGCTGGCGCGGGGAGAACGTGTCCACCACGGAGGTGGAAGCCGTGCTGAGCCGCCTACTGG
GCCAGACGGACGTGGCTGTGTATGGGGTGGCTGTGCCAGGAGTGGAGGGGAAAGCTGGCATGGCAGCCAT
CGCAGATCCCCACAGCCAGTTGGACCCTAACTCAATGTACCAGGAATTACAGAAGGTTCTTGCATCCTAT
GCTCGGCCCATCTTCCTGCGTCTTCTGCCCCAGGTGGATACCACAGGCACCTTCAAGATCCAGAAGACCC
GGCTGCAGCGTGAAGGCTTTGACCCCCGTCAGACCTCAGACAGGCTCTTCTTTCTAGACCTGAAGCAGGG
ACGCTATGTACCCCTGGATGAGAGAGTCCATGCCCGCATTTGTGCAGGCGACTTCTCACTCTGAGCCTGG
AGAGTGGGCTGGGCCTGGACTCCTGAGACCTGGGAGCCTGACACCCCTCTTCGGGTGCTTCTCCTGCCTG
GCCACATGGACAGCAGCACCTGTGAGAGTAGGAAAATGGAACCTGAGTGGCTGGGACCCCTCTCCTACTT
CCCACTATGCATCCATTTTGCCTCTGCCTTGATCTTTTTCTCCATCTCTTTTCTCCCTACCCAGCAGGAG
CCCCACAAACA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:5362790), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 28424. Forward Primer - name:028424_F_IRAV63-66_M14_Slc27a1, sequence:ACTGCAGCATTGCCAACA; Reverse Primer - name:028424_R_SP6_IRAV63-66_M14_Slc27a1, sequence:GTGTTTGTGGGGCTCCTG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15190 same embryo
 EMAGE:15191 same embryo
 EurExpress:euxassay_010364 same experiment
 MGI:4828169 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS