Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15213

Meis1 Meis homeobox 1 ( MGI:104717)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15213 EMAGE:15213 EMAGE:15213 EMAGE:15213 EMAGE:15213
"Pseudo-wholemount" of euxassay_010373. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010373_01 euxassay_010373_02 euxassay_010373_03 euxassay_010373_04
EMAGE:15213 EMAGE:15213 EMAGE:15213 EMAGE:15213 EMAGE:15213
euxassay_010373_05 euxassay_010373_06 euxassay_010373_07 euxassay_010373_08 euxassay_010373_09
EMAGE:15213 EMAGE:15213 EMAGE:15213 EMAGE:15213 EMAGE:15213
euxassay_010373_10 euxassay_010373_11 euxassay_010373_12 euxassay_010373_13 euxassay_010373_14
EMAGE:15213 EMAGE:15213 EMAGE:15213 EMAGE:15213 EMAGE:15213
euxassay_010373_15 euxassay_010373_16 euxassay_010373_17 euxassay_010373_18 euxassay_010373_19
EMAGE:15213 EMAGE:15213 EMAGE:15213 EMAGE:15213
euxassay_010373_20 euxassay_010373_21 euxassay_010373_22 euxassay_010373_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15213Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15213_wholemount_strong.wlz
15213_wholemount_moderate.wlz
15213_wholemount_weak.wlz
15213_wholemount_possible.wlz
15213_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15213_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
sublingual gland primordium
moderate moderate
regionalmoderate expression: see section 09
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 08 15 16 17 18
vibrissa
moderate moderate
regionalmoderate expression: see section 05 06 07 08 21 22 23
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 15 16
telencephalon mantle layer
strong strong
regionalstrong expression: see section 03 04 05 21 22 23 moderate expression: see section 06 07 08 09 10 11 12 13 17 18 19 20
olfactory cortex mantle layer
moderate moderate
regionalmoderate expression: see section 12 13 14 16 17 18
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16
rest of cerebellum marginal layer
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 11 12 13 14 15 16 17 18 19
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 02 03 04 05 13 14 15 16 17 18 19
pons mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
spinal cord mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15
cornea
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 22 23
neural retina
moderate moderate
regionalmoderate expression: see section 02 03 04 05 22 23
nasal cavity epithelium
moderate moderate
regionalmoderate expression: see section 12 13 14
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 10 11 16 17 18 19
nasal cavity respiratory epithelium
moderate moderate
regionalmoderate expression: see section 16 17
hindgut
moderate moderate
regionalmoderate expression: see section 11 12 13 14
midgut
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 12 13 14
metanephros
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 15 16 17 18 19 weak expression: see section 05
lung
moderate moderate
regionalmoderate expression: see section 05 06 07 13 14 15 16 17 18 weak expression: see section 03 04 08 09 10 12
trachea
weak weak
regionalweak expression: see section 11 12
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30257
Entity Detected:Meis1, Meis homeobox 1 ( MGI:104717)
Sequence:sense strand is shown

>T30257
GAATCCACCTCTCCGCCTGTGCAACACACACTTTACACACGCACGGCGACTGCAAGCGGGCAGCATCGAT
CGTGGCTCCTTTAAGACAAACTCAGACAGACATTTTTTTAACCCTCCTCTCTAATCTCCCTTCAGTGCAG
CAGTTGCAAAGAGGGAGAGAGAAAGAGAAAGAGAGCGAGAGAAGAGAGAAACTGATTAGGAATTAGGACT
GATTCAAGGAAAGCGGGCGCTAGGGCTTTGTGCATTTGAATATTAACATTTGAGGTGTTCTGACCAGAAG
AAGACAGAACGGACGATCATTCATTCACCACGTTGACAACCTCGCCTGTGATTGACAGCTGGAGTGGCAG
AAAGCCATGAGATTTGGTAGTTGGGTCTGAGGGGCGCTCTTTTTTTTTTCTTTTTCTTTTCTTTTCTTTC
TTTTTTTTTAAACTGATTTTTTTGGGGGGGAGAGAAGATCTGCTTTTTTTTCCCCTCCCACTGCTGTCTT
GGTGGAACCAGAGCGCTTTTATGCTCAGCGACGCGGGCGCCTTGCTTCAGGTCCGGTAGACCGAAGATCT
GGGACCAGTAATTCACACTGCTGGAGACGCAAAGGGATTTTTTTTTGTTATTGTTGTGCTTTATTTTTTT
TTTCCGGGGGAGTTTGCATATTTGTTTCTTTTCACACTGGCCTTAAAGAGGATATATTAGAAGTTGAAGT
AGGAAGGGAGCCAGAGAGGCCGATGGCGCAAAGGTACGACGACCTACCCCATTATGGGGGTATGGATGGA
GTAGGCATCCCCTCCACGATGTATGGGGACCCGCATGCAGCCAGGTCCATGCAACCGGTCCACCACCTGA
ACCACGGGCCTCCTCTGCACTCGCATCAGTACCCGCACACAGCTCACACCAACG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:5344307), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 28454. Forward Primer - name:028454_F_IRAV67-70_I16_Meis1, sequence:GAATCCACCTCTCCGCCT; Reverse Primer - name:028454_R_SP6_IRAV67-70_I16_Meis1, sequence:GCGTTGGTGTGAGCTGTG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15211 same embryo
 EMAGE:15216 same embryo
 EMAGE:15215 same embryo
 EMAGE:15212 same embryo
 EMAGE:15214 same embryo
 EurExpress:euxassay_010373 same experiment
 MGI:4826157 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS