Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15328

Ptprm protein tyrosine phosphatase, receptor type, M ( MGI:102694)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15328 EMAGE:15328 EMAGE:15328 EMAGE:15328 EMAGE:15328
"Pseudo-wholemount" of euxassay_010519. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010519_01 euxassay_010519_02 euxassay_010519_03 euxassay_010519_04
EMAGE:15328 EMAGE:15328 EMAGE:15328 EMAGE:15328 EMAGE:15328
euxassay_010519_05 euxassay_010519_06 euxassay_010519_07 euxassay_010519_08 euxassay_010519_09
EMAGE:15328 EMAGE:15328 EMAGE:15328 EMAGE:15328 EMAGE:15328
euxassay_010519_10 euxassay_010519_11 euxassay_010519_12 euxassay_010519_13 euxassay_010519_14
EMAGE:15328 EMAGE:15328 EMAGE:15328 EMAGE:15328 EMAGE:15328
euxassay_010519_15 euxassay_010519_16 euxassay_010519_17 euxassay_010519_18 euxassay_010519_19
EMAGE:15328 EMAGE:15328
euxassay_010519_20 euxassay_010519_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15328Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15328_wholemount_strong.wlz
15328_wholemount_moderate.wlz
15328_wholemount_weak.wlz
15328_wholemount_possible.wlz
15328_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15328_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
body cavity or lining
moderate moderate
spottedmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
limb
moderate moderate
spottedmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
mesenchyme
moderate moderate
spottedmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
vertebral axis musculature
moderate moderate
spottedmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
gland
moderate moderate
spottedmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
alimentary system
moderate moderate
spottedmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
nervous system
moderate moderate
spottedmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
integumental system
moderate moderate
spottedmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
sensory organ system
moderate moderate
spottedmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
cardiovascular system
moderate moderate
spottedmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
urinary system
moderate moderate
spottedmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
reproductive system
moderate moderate
spottedmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
respiratory system
moderate moderate
spottedmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
tail
moderate moderate
spottedmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30503
Entity Detected:Ptprm, protein tyrosine phosphatase, receptor type, M ( MGI:102694)
Sequence:sense strand is shown

>T30503
AGAGCTGGCCATCAGCACGTTCTGGCCCAACTTTTACCAGGTGATTTTTGAAGTGGTGACCTCTGGCCAT
CAAGGCTACCTTGCTATCGATGAAGTTAAGGTCTTAGGACTCCCGTGCACAAGAACTCCCCACTTCCTGC
GGATTCAGAACGTGGAGGTGAATGCCGGCCAGTTTGCTACCTTCCAGTGCAGCGCCATAGGCAGGACAGT
GGCTGGGGACCGGCTCTGGCTGCAGGGAATTGATGTCCGAGATGCCCCTCTGAAGGAGATAAAGGTGACT
AGTTCCAGAAGATTCATAGCCTCATTTAACGTTGTAAACACGACCAAGAGAGACGCTGGGAAGTACCGCT
GCATGATTTGCACGGAAGGAGGTGTCGGGATATCAAACTACGCAGAATTGGTAGTTAAAGAGCCACCTGT
TCCCATCGCCCCACCTCAGCTCGCCTCTGTCGGAGCAACCTATCTGTGGATACAGCTCAATGCCAACTCC
ATCAATGGGGACGGACCCATTGTGGCCCGCGAGGTTGAGTACTGCACAGCCAGCGGGAGCTGGAATGATC
GGCAGCCAGTGGATTCCACGAGTTACAAGATTGGGCACCTTGACCCAGACACAGAGTATGAGATCAGTGT
GCTTCTTACCAGACCAGGAGAAGGCGGCACTGGGTCTCCCGGGCCAGCTCTGAGAACAAGGACAAAGTGT
GCCGATCCCATGCGGGGCCCGAGAAAACTAGAAGTTGTGGAGGTCAAATCTCGACAAATCACCATCCGCT
GGGAGCCGTTTGGATACAATGTAACTCGTTGCCACAGTTATAATCTCACAGTGCACTATGGTTACCAGGT
CGGAGGGCAGGAGCAGGTGCGAGAAGAAGTGAGCTGGGATACAGATAACTCCCACCCTCAGCACACCATC
ACCAACCTGTCCCCGTACACCAACGTCAGCGTGAAGCTTATTCTGATGAACCCGGAGGGTCGCAAGGAAA
GCCAAGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:30056619), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 58808. Forward Primer - name:058808_F_IRAV108_g06_Ptprm, sequence:AGAGCTGGCCATCAGCAC; Reverse Primer - name:058808_R_SP6_IRAV108_g06_Ptprm, sequence:TTCTTGGCTTTCCTTGCG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15324 same embryo
 EMAGE:15327 same embryo
 EMAGE:15326 same embryo
 EMAGE:15325 same embryo
 EMAGE:15323 same embryo
 EurExpress:euxassay_010519 same experiment
 MGI:4827529 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS