Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15403

Epb4.1l4a erythrocyte protein band 4.1-like 4a ( MGI:103007)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15403 EMAGE:15403 EMAGE:15403 EMAGE:15403 EMAGE:15403
"Pseudo-wholemount" of euxassay_010576. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010576_01 euxassay_010576_02 euxassay_010576_03 euxassay_010576_04
EMAGE:15403 EMAGE:15403 EMAGE:15403 EMAGE:15403 EMAGE:15403
euxassay_010576_05 euxassay_010576_06 euxassay_010576_07 euxassay_010576_08 euxassay_010576_09
EMAGE:15403 EMAGE:15403 EMAGE:15403 EMAGE:15403 EMAGE:15403
euxassay_010576_10 euxassay_010576_11 euxassay_010576_12 euxassay_010576_13 euxassay_010576_14
EMAGE:15403 EMAGE:15403 EMAGE:15403 EMAGE:15403 EMAGE:15403
euxassay_010576_15 euxassay_010576_16 euxassay_010576_17 euxassay_010576_18 euxassay_010576_19
EMAGE:15403 EMAGE:15403 EMAGE:15403 EMAGE:15403
euxassay_010576_20 euxassay_010576_21 euxassay_010576_22 euxassay_010576_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15403Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15403_wholemount_strong.wlz
15403_wholemount_moderate.wlz
15403_wholemount_weak.wlz
15403_wholemount_possible.wlz
15403_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15403_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
medulla oblongata part of 4th ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 07 08 10 11 12 13 14 15 16
skin
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
vibrissa
weak weak
regionalweak expression: see section 05 06 07 21 22 23
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16
choroid invagination
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 16 17 18
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 13 14 15
olfactory cortex mantle layer
moderate moderate
regionalmoderate expression: see section 11 12 13 16 17 18
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 09 10
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 13 14
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 13 14 15 16 17 weak expression: see section 11
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 03 04 18 19
pons mantle layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 09 10 15 16 17 18 19 weak expression: see section 11
metencephalon part of 4th ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 17 18 19
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 05 15
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 16 17 18 19 20 21
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 03 05 06 07 14 15 16 17 18 20
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 09 16
basal columns
moderate moderate
regionalmoderate expression: see section 07 08 weak expression: see section 09 10 11
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 06 07 12
cervical ganglion
moderate moderate
regionalmoderate expression: see section 14 weak expression: see section 07
thoracic ganglion
weak weak
regionalweak expression: see section 11 13
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
ear
moderate moderate
regionalmoderate expression: see section 01 02 20 21 23
lens
moderate moderate
regionalmoderate expression: see section 01 02
neural retina
moderate moderate
regionalmoderate expression: see section 02 03 04 22 23
anterior naris
weak weak
regionalweak expression: see section 14
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 10 13 16 17 18 weak expression: see section 09 11 12
stomach
moderate moderate
regionalmoderate expression: see section 06 07 08
rectum
moderate moderate
regionalmoderate expression: see section 14
midgut
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17 18
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 15 16
lower jaw molar
moderate moderate
regionalmoderate expression: see section 06 07 18
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 14 15 16
upper jaw molar
moderate moderate
regionalmoderate expression: see section 06 07 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30772
Entity Detected:Epb4.1l4a, erythrocyte protein band 4.1-like 4a ( MGI:103007)
Sequence:sense strand is shown

>T30772
ATGGGTCAGGCTCCTTCCGAAGCTGAGCTGAATTACTTGAGGACTGCCAAATCCCTGGAGATGTATGGTG
TTGACCTCCATCCTGTCTATGGAGAAAATAAGTCCGAGTACTTCTTAGGCTTGACTCCATCGGGAGTTGT
CGTCTATAAGAATAAAAAGCAAGTGGGGAAGTATTTCTGGCCTCGGATTACAAAGGTGCACTTCAAGGAA
ACCCAGTTTGAGCTCAGAGTCTTGGGAAAAGACTGTAATGAAACCTCATTCTTTTTTGAAGCTCGAAGCA
AAACTGCTTGCAAGCACCTCTGGAAATGCAGCGTAGAGCACCATACGTTTTTCAGAATGCCGGACACAGA
ATCAAATTCATTATCAAGAAAACTCAGCAAGTTTGGGTCCATAAGTTATAAACATCGGTACAGTGGCAGG
ACAGCTTTGCAAATGAGCCGAGATCTTTCTATCCAACTTCCCCGGCCCAATCAGAACGTGGTGAGAAGTC
GAAGCAAGACTTACCCCAAGAGGGTAGCACAGACTCAGCCCACTGGATCAAACAACATCAATCGGATAAC
TGCAAACACGGAAAACGGGGAGAATGAAGGAACCACCAAGATCATTGCGCCTTCCCCAGTGAAAAGTTTT
AAGAAAGCAAAGAATGAAAACAGCCCTGACCCCCAAAGAAGCAAATCTCATGCACCTTGGGAAGAAAACG
GACCGCAGAGTGGACTATACAACTCCTCCAGTGACCGCACTAAGTCACCAAAGTTTCCCTGTGCCCGGCA
GCGCAACCTCTCCTGCGGCAGCGACAATGACTCCTCACAACTGATGAGGCGAAGGAAAGCTCAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3490326), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 11256. Forward Primer - name:011256_F_IRAV16-19_B01_Epb4.1l4a, sequence:ATGGGTCAGGCTCCTTCC; Reverse Primer - name:011256_R_SP6_IRAV16-19_B01_Epb4.1l4a, sequence:TGTGAGCTTTCCTTCGCC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15400 same embryo
 EMAGE:15402 same embryo
 EMAGE:15405 same embryo
 EMAGE:15401 same embryo
 EMAGE:15404 same embryo
 EurExpress:euxassay_010576 same experiment
 MGI:4824572 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS