Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15405

Ndrg2 N-myc downstream regulated gene 2 ( MGI:1352498)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15405 EMAGE:15405 EMAGE:15405 EMAGE:15405 EMAGE:15405
"Pseudo-wholemount" of euxassay_010581. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010581_01 euxassay_010581_02 euxassay_010581_03 euxassay_010581_04
EMAGE:15405 EMAGE:15405 EMAGE:15405 EMAGE:15405 EMAGE:15405
euxassay_010581_05 euxassay_010581_06 euxassay_010581_07 euxassay_010581_08 euxassay_010581_09
EMAGE:15405 EMAGE:15405 EMAGE:15405 EMAGE:15405 EMAGE:15405
euxassay_010581_10 euxassay_010581_11 euxassay_010581_12 euxassay_010581_13 euxassay_010581_14
EMAGE:15405 EMAGE:15405 EMAGE:15405 EMAGE:15405 EMAGE:15405
euxassay_010581_15 euxassay_010581_16 euxassay_010581_17 euxassay_010581_18 euxassay_010581_19
EMAGE:15405 EMAGE:15405
euxassay_010581_20 euxassay_010581_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15405Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15405_wholemount_strong.wlz
15405_wholemount_moderate.wlz
15405_wholemount_weak.wlz
15405_wholemount_possible.wlz
15405_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15405_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
medulla oblongata part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14
rib
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 12 13 14 15 16 17 18
humerus
moderate moderate
regionalmoderate expression: see section 02 03 17
forelimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 01 02 03 04 20 21
forelimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 21
forelimb digit 4 phalanx
moderate moderate
regionalmoderate expression: see section 04
hindlimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 07
hindlimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 04 05 06 07
hindlimb digit 4 phalanx
moderate moderate
regionalmoderate expression: see section 06 07
hindlimb digit 5 phalanx
moderate moderate
regionalmoderate expression: see section 06
femur
moderate moderate
regionalmoderate expression: see section 16 17 18 19
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 10 11 12
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 moderate expression: see section 02 03 04 05 19
medulla oblongata alar plate ventricular layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 05 06 07 08 09
pons ventricular layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14
metencephalon part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 05
midbrain ventricular layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 15 16 17
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 04 05
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 14 15 16 17 18 19
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 05 13
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 03 05 14 15 16
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16
otic capsule
moderate moderate
regionalmoderate expression: see section 05 06 07 12 13 14
naris
moderate moderate
regionalmoderate expression: see section 14
anterior naris
moderate moderate
regionalmoderate expression: see section 10 11 15 16
nasal septum
moderate moderate
regionalmoderate expression: see section 12 13
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
heart ventricle
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13
rectum
strong strong
regionalstrong expression: see section 12 moderate expression: see section 13
cricoid cartilage
moderate moderate
regionalmoderate expression: see section 10
thyroid cartilage
moderate moderate
regionalmoderate expression: see section 10
sternum
moderate moderate
regionalmoderate expression: see section 07 08 10 11
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30846
Entity Detected:Ndrg2, N-myc downstream regulated gene 2 ( MGI:1352498)
Sequence:sense strand is shown

>T30846
ATCTCGGTCTCGCACAGCATCTCTGACCAGTGCAGCATCCATCGATGGCAGTCGGTCCCGATCCCGCACC
CTGTCGCAGAGTAGCGAGTCTGGGACTCTCCCTTCTGGACCCCCAGGGCACACCATGGAAGTCTCCTGTT
GAATGACCCTCATTGCCTTGGTGTGGATCCCAGCCCTCACCTCCTGCAACACTAACTTAAGAGGTGTTAT
CAGGGCACTGGGCCAGAGTAAGCAAGGAAAATGGGCAGATTGTGCAGGGAGATGACCTTGATCTTTAATT
GCTACCCTAACCTTGACCTTTAACCTGTGATATCCTCTAGCTCCTAGGTGAGGTGTCCTAATATCTCTTA
GAGATCTGGGCCCCCTAAATTACCCCCTCTTCCATTTTGGTGTTGAGAAGGCTTGTATGTTCTCTCTCTG
ACCTAGGTTCTATAGATGAGGAACAATGAGCTGTTCTAGCTGACACGGGGCCTCCATCACTCCCCCTCTT
TAGCCCATATTTGCAAGGGTAGGAGAGAGAGTGTGTGTGTGTTGTGTGTGGTGTTGTGTGTGTGTAGGGT
TGATGGTGAGAGATGGGGAGCTCCTTCCCCAAAGCTGACAGTGGCTTTGCCTTGATGTGTCAGGCCTCTC
TGAAGGCAATAGTCCCAAATGAATGTTTATCAGGAGAAGGTTTGCTGGTGGGTCAGCGATCCTTAATGTG
ATAGAAATATCCAGCATGTAAAAAGAAAGGATGGGAGATGGTGGCCCGTGAAGAACAGTGGTAAACACAT
TGAAGCTGGGGTAGAAGGGAGGGACCCAGGTCCTTTGGCCGCACTA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4211421), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 36610. Forward Primer - name:036610_F_IRAV20-23_N20_Ndrg2, sequence:ATCTCGGTCTCGCACAGC; Reverse Primer - name:036610_R_SP6_IRAV20-23_N20_Ndrg2, sequence:TTAGTGCGGCCAAAGGAC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15400 same embryo
 EMAGE:15403 same embryo
 EMAGE:15402 same embryo
 EMAGE:15401 same embryo
 EMAGE:15404 same embryo
 EurExpress:euxassay_010581 same experiment
 MGI:4826633 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS