Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15581

Lepr leptin receptor ( MGI:104993)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15581 EMAGE:15581 EMAGE:15581 EMAGE:15581 EMAGE:15581
"Pseudo-wholemount" of euxassay_010749. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010749_01 euxassay_010749_02 euxassay_010749_03 euxassay_010749_04
EMAGE:15581 EMAGE:15581 EMAGE:15581 EMAGE:15581 EMAGE:15581
euxassay_010749_05 euxassay_010749_06 euxassay_010749_07 euxassay_010749_08 euxassay_010749_09
EMAGE:15581 EMAGE:15581 EMAGE:15581 EMAGE:15581 EMAGE:15581
euxassay_010749_10 euxassay_010749_11 euxassay_010749_12 euxassay_010749_13 euxassay_010749_14
EMAGE:15581 EMAGE:15581 EMAGE:15581 EMAGE:15581 EMAGE:15581
euxassay_010749_15 euxassay_010749_16 euxassay_010749_17 euxassay_010749_18 euxassay_010749_19
EMAGE:15581 EMAGE:15581 EMAGE:15581
euxassay_010749_20 euxassay_010749_21 euxassay_010749_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15581Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15581_wholemount_strong.wlz
15581_wholemount_moderate.wlz
15581_wholemount_weak.wlz
15581_wholemount_possible.wlz
15581_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15581_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 01 02 03 04 05 13 14 15 16 17 18 19 20
upper arm mesenchyme
strong strong
regionalstrong expression: see section 01 02 18 19 20
hand
strong strong
regionalstrong expression: see section 01 02 03 21 22
foot
strong strong
regionalstrong expression: see section 07 08
lower leg mesenchyme
strong strong
regionalstrong expression: see section 03
upper leg mesenchyme
strong strong
regionalstrong expression: see section 03 18 19 20
diencephalon meninges
strong strong
regionalstrong expression: see section 04 05 13 14 15 16 17 moderate expression: see section 06 07 08 09 10 11 12 18
telencephalon meninges
strong strong
regionalstrong expression: see section 01 02 03 04 05 13 14 15 16 17 19 20 21 22 moderate expression: see section 06 07 08 09 10 11 12 18
hindbrain meninges
strong strong
regionalstrong expression: see section 02 03 04 05 13 14 15 16 17 19 moderate expression: see section 06 07 08 09 10 11 12 18
midbrain meninges
strong strong
regionalstrong expression: see section 04 05 13 14 15 16 17 moderate expression: see section 06 07 08 09 10 11 12
spinal cord meninges
strong strong
regionalstrong expression: see section 04 05 13 14 moderate expression: see section 06 07 08 09 10 11 12
otic capsule
strong strong
regionalstrong expression: see section 04 05 06 07 14 15 16 17
mandible
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20
maxilla
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 15 16 17 18 19 20
palatal shelf
strong strong
regionalstrong expression: see section 07
axial skeleton
strong strong
regionalstrong expression: see section 05 06 07 11 13 14
temporal bone petrous part
strong strong
regionalstrong expression: see section 01 02 18 19 20
scapula
strong strong
regionalstrong expression: see section 01 17 18
pelvic girdle skeleton
strong strong
regionalstrong expression: see section 06 07 08 09 10 14 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38124
Entity Detected:Lepr, leptin receptor ( MGI:104993)
Sequence:sense strand is shown

>T38124
CTTTCAGACTGTCCAATGCAACTGCAGTCTTCGGGGTTGTGAATGTCATGTGCCGGTACCCAGAGCCAAA
CTCAACTACGCTCTTCTGATGTATTTGGAAATCACATCTGCCGGTGTGAGTTTTCAGTCACCTCTGATGT
CACTGCAGCCCATGCTTGTTGTGAAACCCGATCCACCCTTAGGTTTGCATATGGAAGTCACAGATGATGG
TAATTTAAAGATTTCTTGGGACAGCCAAACAATGGCACCATTTCCGCTTCAATATCAGGTGAAATATTTA
GAGAATTCTACAATTGTAAGAGAGGCTGCTGAAATTGTCTCAGCTACATCTCTGCTGGTAGACAGTGTGC
TTCCTGGATCTTCATATGAGGTCCAGGTGAGGAGCAAGAGACTGGATGGTTCAGGAGTCTGGAGTGACTG
GAGTTCACCTCAAGTCTTTACCACACAAGATGTTGTGTATTTTCCACCCAAAATTCTGACTAGTGTTGGA
TCGAATGCTTCTTTTCATTGCATCTACAAAAACGAAAACCAGATTATCTCCTCAAAACAGATAGTTTGGT
GGAGGAATCTAGCTGAGAAAATCCCTGAGATACAGTACAGCATTGTGAGTGACCGAGTTAGCAAAGTTAC
CTTCTCCAACCTGAAAGCCACCAGACCTCGAGGGAAGTTTACCTATGACGCAGTGTACTGCTGCAATGAG
CAGGCGTGCCATCACCGCTATGCTGAATTATACGTGATCGATGTCAATATCAATATATCATGTGAAACTG
ACGGGTACTTAACTAAAATGACTTGCAGATGGTCACCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 104197. Forward Primer - name:104197_F_cDNA_Lepr, sequence:CTTTCAGACTGTCCAATGCAAC; Reverse Primer - name:104197_N_SP6_cDNA_Lepr, sequence:GGGTGACCATCTGCAAGTCAT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15580 same embryo
 EMAGE:15584 same embryo
 EMAGE:15579 same embryo
 EMAGE:15582 same embryo
 EMAGE:15583 same embryo
 EurExpress:euxassay_010749 same experiment
 MGI:4825900 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS