Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15755

Ldhb lactate dehydrogenase B ( MGI:96763)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15755 EMAGE:15755 EMAGE:15755 EMAGE:15755 EMAGE:15755
"Pseudo-wholemount" of euxassay_013176. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013176_01 euxassay_013176_02 euxassay_013176_03 euxassay_013176_04
EMAGE:15755 EMAGE:15755 EMAGE:15755 EMAGE:15755 EMAGE:15755
euxassay_013176_05 euxassay_013176_06 euxassay_013176_07 euxassay_013176_08 euxassay_013176_09
EMAGE:15755 EMAGE:15755 EMAGE:15755 EMAGE:15755 EMAGE:15755
euxassay_013176_10 euxassay_013176_11 euxassay_013176_12 euxassay_013176_13 euxassay_013176_14
EMAGE:15755 EMAGE:15755 EMAGE:15755 EMAGE:15755 EMAGE:15755
euxassay_013176_15 euxassay_013176_16 euxassay_013176_17 euxassay_013176_18 euxassay_013176_19
EMAGE:15755 EMAGE:15755 EMAGE:15755 EMAGE:15755 EMAGE:15755
euxassay_013176_20 euxassay_013176_21 euxassay_013176_22 euxassay_013176_23 euxassay_013176_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15755Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15755_wholemount_strong.wlz
15755_wholemount_moderate.wlz
15755_wholemount_weak.wlz
15755_wholemount_possible.wlz
15755_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15755_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium mesenchyme
strong strong
regionalstrong expression: see section 05 06 07 08 15 16 17 18 19
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
cerebral cortex
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
spinal cord
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
heart atrium
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 15 16 17 18 19 20 21
heart ventricle
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16
renal cortex
strong strong
regionalstrong expression: see section 06 07 08 09 10 15 16 17 18 19 20
left lung
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10
right lung
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17 18 19 20 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39330
Entity Detected:Ldhb, lactate dehydrogenase B ( MGI:96763)
Sequence:sense strand is shown

>T39330
GTAGTGGGCGTTGGACAAGTGGGTATGGCGTGTGCCATCAGCATTCTGGGAAAGTCTCTGGCTGATGAAC
TTGCTCTGGTGGATGTGTTGGAAGACAAGCTCAAAGAAGAGATGATGGACCTGCAGCACGGGAGCTTGTT
CCTCCAGACTCCGAAAATTGTGGCCGATAAAGATTACTCTGTGACAGCCAACTCTAAGATTGTGGTGGTG
TCCGCAGGAGTGCGCCAGCAGGAGGGGGAGAGTCGGCTCAACCTGGTGCAGAGAAATGTCAATGTGTTCA
AGTTCATCATTCCTCAGATCGTCAAATACAGCCCTGACTGCACCATCATCGTGGTTTCCAACCCAGTGGA
TATTCTGACTTATGTCACCTGGAAACTGAGAGGGCTACCTAAGCACCGTGTGATTGGAAGCGGATGCAAT
CTGGATTCTGCTCGATTCCGCTACCTCATGGCAGAGAAGCTTGGCATTCATCCCAGCAGCTGCCATGGAT
GGATCCTGGGCGAGCATGGAGACTCCAGTGTGGCTGTGTGGAGCGGGGTGAATGTGGCAGGAGTCTCCCT
CCAGGAACTGAATCCAGAAATGGGGACAGACAATGACAGTGAGAACTGGAAGGAGGTGCATAAGATGGTG
GTGGTCAGTGCCTATGAAGTCATCAAGCTCAAAGGCTACACCAACTGGGCCATCGGCCTGAGCGTGGCTG
ACCTCATCGAGTCCATGCTGAAAAACCTCTCCCGGATTCACCCCGTGTCTACCATGGTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 277449. Forward Primer - name:277449_F_cDNA_LOC433229, sequence:GTAGTGGGCGTTGGACAAGT; Reverse Primer - name:277449_N_SP6_cDNA_LOC433229, sequence:CACCATGGTAGACACGGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15756 same assay
 EMAGE:15757 same embryo
 EMAGE:15762 same embryo
 EMAGE:15758 same embryo
 EMAGE:15759 same embryo
 EMAGE:15760 same embryo
 EMAGE:15754 same embryo
 EurExpress:euxassay_013176 same experiment
 MGI:4825890 same experiment
 MGI:4825891 same experiment
 EMAGE:15761 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS