Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15875

D430041D05Rik RIKEN cDNA D430041D05 gene ( MGI:2181743)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15875 EMAGE:15875 EMAGE:15875 EMAGE:15875 EMAGE:15875
"Pseudo-wholemount" of euxassay_013276. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013276_01 euxassay_013276_02 euxassay_013276_03 euxassay_013276_04
EMAGE:15875 EMAGE:15875 EMAGE:15875 EMAGE:15875 EMAGE:15875
euxassay_013276_05 euxassay_013276_06 euxassay_013276_07 euxassay_013276_08 euxassay_013276_09
EMAGE:15875 EMAGE:15875 EMAGE:15875 EMAGE:15875 EMAGE:15875
euxassay_013276_10 euxassay_013276_11 euxassay_013276_12 euxassay_013276_13 euxassay_013276_14
EMAGE:15875 EMAGE:15875 EMAGE:15875 EMAGE:15875 EMAGE:15875
euxassay_013276_15 euxassay_013276_16 euxassay_013276_17 euxassay_013276_18 euxassay_013276_19
EMAGE:15875 EMAGE:15875 EMAGE:15875 EMAGE:15875
euxassay_013276_20 euxassay_013276_21 euxassay_013276_22 euxassay_013276_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15875Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15875_wholemount_strong.wlz
15875_wholemount_moderate.wlz
15875_wholemount_weak.wlz
15875_wholemount_possible.wlz
15875_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15875_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
cerebral cortex marginal layer
weak weak
regionalweak expression: see section 02 03 05 06 07 08 10 11 12 13 14 15 16 17 18 19 20 21 22 23
olfactory cortex marginal layer
weak weak
regionalweak expression: see section 11 12 13 16 17 18
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 08 13 14
facial vii ganglion
weak weak
regionalweak expression: see section 04 18 19
ventral grey horn
moderate moderate
regionalmoderate expression: see section 14 16 weak expression: see section 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39981
Entity Detected:D430041D05Rik, RIKEN cDNA D430041D05 gene ( MGI:2181743)
Sequence:sense strand is shown

>T39981
CAGAACCAGAACCAGGAAAAACTCCTGCAGTACGGGGAAGCAGCCCGGGACAACCCTGTGTTTTGTGTTG
TGTCCTAAGGAGGGTGTGTTCTAAGGCTGCTGTGGGGCTCTGGGACTGCAGTAGTCCCTGCAAATCAGCC
ATGATTGGTAAGACTGTATGTGATAAGACCGGGGATTGCCTGAAGGAAGATCTAGGGAACTCCTATGAGG
AAAGAGGAACGTTTGGCCATTGGAAGTGTACTTCCTCCTTAAAGAAGAAGCCATGTGCTGAGTGAATTGG
GTTTTATCAACTCTCTCTAATTTGCTTGTCTCTTCACAGGCCTACAGGTTCTCCCAGCTTCCTGAGATGG
TCATGGGCTCTCCCCCGCCCCCAGTTCCACCTCGAACAGGCCCTGTGGCCGTGGCTTCCCTCAGGAGGTC
CACCTCAGACATTGGCAGCAAGACCCGGATGGCGGAGTCCACGGGACCTGAGCCCACCCAGTTGCATGAC
AGTGCCTCATTTGCCCAGGTGTCCAGAGGTCCCGTGTCCGTGACGCAGTTGGATCAGTCGGCTTTAAATT
ACTCAGGTAACACGGTGCCAGCGGTGTTTGCCATCCCAGCTGCCAACAGACCCGGCTTCACCGGCTACTT
CATCCCAACACCACCCTCATCCTACAGGAGCCAGGCTTGGAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 106622. Forward Primer - name:106622_F_cDNA_LOC433459, sequence:CAGAACCAGAACCAGGAAAAAC; Reverse Primer - name:106622_N_SP6_cDNA_LOC433459, sequence:ATCCAAGCCTGGCTCCTGTAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15870 same embryo
 EMAGE:15871 same embryo
 EMAGE:15874 same embryo
 EMAGE:15872 same embryo
 EMAGE:15873 same embryo
 EurExpress:euxassay_013276 same experiment
 MGI:4824204 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS