Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15910

Ptpn3 protein tyrosine phosphatase, non-receptor type 3 ( MGI:105307)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15910 EMAGE:15910 EMAGE:15910 EMAGE:15910 EMAGE:15910
"Pseudo-wholemount" of euxassay_013372. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013372_01 euxassay_013372_02 euxassay_013372_03 euxassay_013372_04
EMAGE:15910 EMAGE:15910 EMAGE:15910 EMAGE:15910 EMAGE:15910
euxassay_013372_05 euxassay_013372_06 euxassay_013372_07 euxassay_013372_08 euxassay_013372_09
EMAGE:15910 EMAGE:15910 EMAGE:15910 EMAGE:15910 EMAGE:15910
euxassay_013372_10 euxassay_013372_11 euxassay_013372_12 euxassay_013372_13 euxassay_013372_14
EMAGE:15910 EMAGE:15910 EMAGE:15910 EMAGE:15910 EMAGE:15910
euxassay_013372_15 euxassay_013372_16 euxassay_013372_17 euxassay_013372_18 euxassay_013372_19
EMAGE:15910 EMAGE:15910 EMAGE:15910 EMAGE:15910 EMAGE:15910
euxassay_013372_20 euxassay_013372_21 euxassay_013372_22 euxassay_013372_23 euxassay_013372_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15910Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15910_wholemount_strong.wlz
15910_wholemount_moderate.wlz
15910_wholemount_weak.wlz
15910_wholemount_possible.wlz
15910_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15910_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 10 11 13 14 weak expression: see section 12
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 15 16 17 18
pancreas
moderate moderate
regionalmoderate expression: see section 10 11 12
vibrissa
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 21 22 23
facial vii ganglion
strong strong
regionalstrong expression: see section 03 04 05 18 19 20 21
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 06 07 17
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 17 18 19 20 21 22
vagus x ganglion
strong strong
regionalstrong expression: see section 07 16 17
dorsal root ganglion
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
anterior naris epithelium
strong strong
regionalstrong expression: see section 12 13 moderate expression: see section 15 16 17
external naris epithelium
strong strong
regionalstrong expression: see section 11 12 moderate expression: see section 17
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 09 11 12 13 15 16 moderate expression: see section 10 17 18 19
esophagus epithelium
moderate moderate
regionalmoderate expression: see section 10 11
stomach
moderate moderate
regionalmoderate expression: see section 02 03 04 05 weak expression: see section 06 07 08 09 10
rectum
moderate moderate
regionalmoderate expression: see section 15 16
midgut
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17 18 19
bladder
moderate moderate
regionalmoderate expression: see section 14 15
metanephros
strong strong
regionalstrong expression: see section 07 08 09 10 15 16 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T40132
Entity Detected:Ptpn3, protein tyrosine phosphatase, non-receptor type 3 ( MGI:105307)
Sequence:sense strand is shown

>T40132
GCCAGTTATGTGAACATGGAGATGCCCGCTGCTAACCTTGTGAACAAGTACATTGCCACTCAGGGACCGC
TGCCAAACACCTGTGCACAGTTTTGGCAAGTTGTCTGGGATCAGAAGTTGTCTCTTGTTGTCATGCTGAC
GACTCTCACCGAGCGAGGGCGGCCCCAGTCCACGCCCACTTCCGACTCAGTCATTCCAGGTGAATGGCTT
TGCCCCTCCTTTGATACCAAATGTCACCAGTACTGGCCGGATCCCCCTGACATCATGGACCATGGCATCT
TTCACATCCAGTGTCAGACAGAGGACTGTACCATTGCTTACGTGTCCCGAGAAATGCTAGTTACAAACAC
GGAGACCGGGGAAGAACACACAGTGACCCATCTCCAGTATGTGGCGTGGCCTGACCACGGCGTACCTGAT
GACTCATCAGACTTCCTGGAGTTTGTGAAGTATGTGAGGTCCCTGAGGGTCGACGGTGAGCCTGCCCTCG
TTCACTGCAGTGCTGGAATAGGTCGGACAGGTGTTTTAGTCACTATGGAAACAGCCATGTGCTTAATTGA
GAGGAACCTGCCTGTTTACCCACTGGATATTGTCCGGAAAATGAGAGACCAGCGCGCGATGATGGTGCAG
ACGTCAAGCCAATACAAGTTTGTGTGTGAAGCGATCCTTCGAGTGTACGAAGAAGGCTTAGTCCAGAGGC
TGGATCCCAGTTAGGACAACTGTGAAGTGGTCGTTCCTCCTTCCCTAGGGCGACTTCCTGAAGAAGGGGG
CACACATTCCCCTGGAGGCCCCCCCAGAGATGCTGGTCACTGTGGGAAAGGGATGAGCTTATCTGAACCC
AGGCACTTTAAATTTCTGTGGAAAAGATACCCTGTACA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 107287. Forward Primer - name:107287_F_cDNA_LOC433708, sequence:GCCAGTTATGTGAACATGGAGA; Reverse Primer - name:107287_N_SP6_cDNA_LOC433708, sequence:TGTACAGGGTATCTTTTCCACAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15912 same embryo
 EMAGE:15907 same embryo
 EMAGE:15908 same embryo
 EMAGE:15911 same embryo
 EMAGE:15909 same embryo
 EurExpress:euxassay_013372 same experiment
 MGI:4827519 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS