Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16331

Mir686 microRNA 686 ( MGI:3629913)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16331 EMAGE:16331 EMAGE:16331 EMAGE:16331 EMAGE:16331
"Pseudo-wholemount" of euxassay_019134. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019134_01 euxassay_019134_02 euxassay_019134_03 euxassay_019134_04
EMAGE:16331 EMAGE:16331 EMAGE:16331 EMAGE:16331 EMAGE:16331
euxassay_019134_05 euxassay_019134_06 euxassay_019134_07 euxassay_019134_08 euxassay_019134_09
EMAGE:16331 EMAGE:16331 EMAGE:16331 EMAGE:16331 EMAGE:16331
euxassay_019134_10 euxassay_019134_11 euxassay_019134_12 euxassay_019134_13 euxassay_019134_14
EMAGE:16331 EMAGE:16331 EMAGE:16331 EMAGE:16331 EMAGE:16331
euxassay_019134_15 euxassay_019134_16 euxassay_019134_17 euxassay_019134_18 euxassay_019134_19
EMAGE:16331 EMAGE:16331 EMAGE:16331 EMAGE:16331 EMAGE:16331
euxassay_019134_20 euxassay_019134_21 euxassay_019134_22 euxassay_019134_23 euxassay_019134_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16331Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16331_wholemount_strong.wlz
16331_wholemount_moderate.wlz
16331_wholemount_weak.wlz
16331_wholemount_possible.wlz
16331_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16331_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 01 02 03 04 17 18 19 20 21 weak expression: see section 05 22
mandible
strong strong
regionalstrong expression: see section 04 05 06 07 17 18 19 20 moderate expression: see section 03 08 09 16 21
maxilla
strong strong
regionalstrong expression: see section 05 06 17 18 moderate expression: see section 07 08 09 20
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 02 03 04 23 24 weak expression: see section 22
clavicle
moderate moderate
regionalmoderate expression: see section 19 weak expression: see section 06 07 08 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70135
Entity Detected:Mir686, microRNA 686 ( MGI:3629913)
Sequence:sense strand is shown

>T70135
ATTGCTTCCCAGACGGTGAAGA
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-686 was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:16329 same embryo
 EMAGE:16330 same embryo
 EMAGE:16332 same embryo
 EurExpress:euxassay_019134 same experiment
 MGI:4826364 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS