Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16391

Mir700 microRNA 700 ( MGI:3629655)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16391 EMAGE:16391 EMAGE:16391 EMAGE:16391 EMAGE:16391
"Pseudo-wholemount" of euxassay_019136. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019136_01 euxassay_019136_02 euxassay_019136_03 euxassay_019136_04
EMAGE:16391 EMAGE:16391 EMAGE:16391 EMAGE:16391 EMAGE:16391
euxassay_019136_05 euxassay_019136_06 euxassay_019136_07 euxassay_019136_08 euxassay_019136_09
EMAGE:16391 EMAGE:16391 EMAGE:16391 EMAGE:16391 EMAGE:16391
euxassay_019136_10 euxassay_019136_11 euxassay_019136_12 euxassay_019136_13 euxassay_019136_14
EMAGE:16391 EMAGE:16391 EMAGE:16391 EMAGE:16391 EMAGE:16391
euxassay_019136_15 euxassay_019136_16 euxassay_019136_17 euxassay_019136_18 euxassay_019136_19
EMAGE:16391 EMAGE:16391 EMAGE:16391 EMAGE:16391 EMAGE:16391
euxassay_019136_20 euxassay_019136_21 euxassay_019136_22 euxassay_019136_23 euxassay_019136_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16391Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16391_wholemount_strong.wlz
16391_wholemount_moderate.wlz
16391_wholemount_weak.wlz
16391_wholemount_possible.wlz
16391_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16391_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
humerus
weak weak
regionalweak expression: see section 01 02 03 04 21 22 23 24
hindlimb digit 2 metatarsal
weak weak
regionalweak expression: see section 23
hindlimb digit 3 metatarsal
weak weak
regionalweak expression: see section 23
hindlimb digit 4 metatarsal
weak weak
regionalweak expression: see section 23
hindlimb digit 5 metatarsal
weak weak
regionalweak expression: see section 23
fibula
weak weak
regionalweak expression: see section 04 05 06 24
tibia
weak weak
regionalweak expression: see section 04 05 06
femur
weak weak
regionalweak expression: see section 05 06 07 08 09 22 23
meckel's cartilage
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 20 21 22 23
basisphenoid bone
weak weak
regionalweak expression: see section 09 14 15 16
exoccipital bone
weak weak
regionalweak expression: see section 02 03 04 05 19 20 22
temporal bone
weak weak
regionalweak expression: see section 02 03 04 20 21 22 23 24
orbito-sphenoid
weak weak
regionalweak expression: see section 02 03 05 06 07 08 09 14 15 19 20 21 22 23 24
viscerocranium
weak weak
regionalExpression in the turbinate bone.
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70150
Entity Detected:Mir700, microRNA 700 ( MGI:3629655)
Sequence:sense strand is shown

>T70150
CACGCGGGAACCGAGTCCACC
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-700 was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:MGI:4826369 same experiment
 EurExpress:euxassay_019136 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS