Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16403

Mir324 microRNA 324 ( MGI:3619335)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16403 EMAGE:16403 EMAGE:16403 EMAGE:16403 EMAGE:16403
"Pseudo-wholemount" of euxassay_019156. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019156_01 euxassay_019156_02 euxassay_019156_03 euxassay_019156_04
EMAGE:16403 EMAGE:16403 EMAGE:16403 EMAGE:16403 EMAGE:16403
euxassay_019156_05 euxassay_019156_06 euxassay_019156_07 euxassay_019156_08 euxassay_019156_09
EMAGE:16403 EMAGE:16403 EMAGE:16403 EMAGE:16403 EMAGE:16403
euxassay_019156_10 euxassay_019156_11 euxassay_019156_12 euxassay_019156_13 euxassay_019156_14
EMAGE:16403 EMAGE:16403 EMAGE:16403 EMAGE:16403 EMAGE:16403
euxassay_019156_15 euxassay_019156_16 euxassay_019156_17 euxassay_019156_18 euxassay_019156_19
EMAGE:16403 EMAGE:16403 EMAGE:16403
euxassay_019156_20 euxassay_019156_21 euxassay_019156_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16403Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16403_wholemount_strong.wlz
16403_wholemount_moderate.wlz
16403_wholemount_weak.wlz
16403_wholemount_possible.wlz
16403_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16403_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
vibrissa
weak weak
regionalweak expression: see section 04 05 06 07 08 11 20 22
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 08 weak expression: see section 17
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 weak expression: see section 16 17 18 19 20
dorsal root ganglion
weak weak
regionalweak expression: see section 07 08 09 12 13 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70400
Entity Detected:Mir324, microRNA 324 ( MGI:3619335)
Sequence:sense strand is shown

>T70400
CCACTGCCCCAGGTGCTGCT
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-324-3p was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:16400 same embryo
 EMAGE:16399 same embryo
 EMAGE:16401 same embryo
 EMAGE:16402 same embryo
 EurExpress:euxassay_019156 same experiment
 MGI:4826269 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS