Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16459

Mir697 microRNA 697 ( MGI:3629652)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16459 EMAGE:16459 EMAGE:16459 EMAGE:16459 EMAGE:16459
"Pseudo-wholemount" of euxassay_019120. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019120_01 euxassay_019120_02 euxassay_019120_03 euxassay_019120_04
EMAGE:16459 EMAGE:16459 EMAGE:16459 EMAGE:16459 EMAGE:16459
euxassay_019120_05 euxassay_019120_06 euxassay_019120_07 euxassay_019120_08 euxassay_019120_09
EMAGE:16459 EMAGE:16459 EMAGE:16459 EMAGE:16459 EMAGE:16459
euxassay_019120_10 euxassay_019120_11 euxassay_019120_12 euxassay_019120_13 euxassay_019120_14
EMAGE:16459 EMAGE:16459 EMAGE:16459 EMAGE:16459 EMAGE:16459
euxassay_019120_15 euxassay_019120_16 euxassay_019120_17 euxassay_019120_18 euxassay_019120_19
EMAGE:16459
euxassay_019120_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16459Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16459_wholemount_strong.wlz
16459_wholemount_moderate.wlz
16459_wholemount_weak.wlz
16459_wholemount_possible.wlz
16459_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16459_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 13 14 15 16 17 18 19
humerus
moderate moderate
regionalmoderate expression: see section 01 02 17 18 19 20
fibula
weak weak
regionalweak expression: see section 01 02 03
tibia
weak weak
regionalweak expression: see section 01 03
femur
weak weak
regionalweak expression: see section 01 02 03 04 05 17 18 19 20
otic capsule
moderate moderate
regionalmoderate expression: see section 05 06 07 08 13 14
nasal septum
moderate moderate
regionalmoderate expression: see section 13 14
hyoid
weak weak
regionalweak expression: see section 06 07 08 09
mandible
moderate moderate
regionalmoderate expression: see section 03 04 05 06 15 16 17 weak expression: see section 18
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 19 weak expression: see section 18
axial skeleton
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 07 08 09 11 12 13 weak expression: see section 10 14
exoccipital bone
moderate moderate
regionalmoderate expression: see section 02 03 15 16 17 18 19 20
temporal bone
moderate moderate
regionalmoderate expression: see section 01 02 03 04 16 17 18 19 20
vault of skull
moderate moderate
regionalmoderate expression: see section 01 02 03 04
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 02 03 04 05 07 08 09 11 12 13 17 18 19 20 weak expression: see section 06 10 14
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
clavicle
moderate moderate
regionalmoderate expression: see section 13 14 weak expression: see section 05 06 07 15 16
scapula
moderate moderate
regionalmoderate expression: see section 01 17
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 06 07 08 14 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70147
Entity Detected:Mir697, microRNA 697 ( MGI:3629652)
Sequence:sense strand is shown

>T70147
AACATCCTGGTCCTGTGGAGA
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-697 was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:MGI:4826368 same experiment
 EurExpress:euxassay_019120 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS