Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16545

Arhgap12 Rho GTPase activating protein 12 ( MGI:1922665)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16545 EMAGE:16545 EMAGE:16545 EMAGE:16545 EMAGE:16545
"Pseudo-wholemount" of euxassay_008610. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008610_01 euxassay_008610_02 euxassay_008610_03 euxassay_008610_04
EMAGE:16545 EMAGE:16545 EMAGE:16545 EMAGE:16545 EMAGE:16545
euxassay_008610_05 euxassay_008610_06 euxassay_008610_07 euxassay_008610_08 euxassay_008610_09
EMAGE:16545 EMAGE:16545 EMAGE:16545 EMAGE:16545 EMAGE:16545
euxassay_008610_10 euxassay_008610_11 euxassay_008610_12 euxassay_008610_13 euxassay_008610_14
EMAGE:16545 EMAGE:16545 EMAGE:16545 EMAGE:16545 EMAGE:16545
euxassay_008610_15 euxassay_008610_16 euxassay_008610_17 euxassay_008610_18 euxassay_008610_19
EMAGE:16545 EMAGE:16545 EMAGE:16545
euxassay_008610_20 euxassay_008610_21 euxassay_008610_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16545Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16545_wholemount_strong.wlz
16545_wholemount_moderate.wlz
16545_wholemount_weak.wlz
16545_wholemount_possible.wlz
16545_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16545_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
femur
strong strong
regionalstrong expression: see section 09
brain
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
facial vii ganglion
strong strong
regionalstrong expression: see section 03 04 17
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 05 15
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 15 16 17 18
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 15 16
trigeminal v nerve
strong strong
regionalstrong expression: see section 15
spinal cord
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16
dorsal root ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 12 13 14 15 16 17
neural retina
strong strong
regionalstrong expression: see section 01 02 03 04 20 21 22
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 09 10 11 12 14 15 16 17 18
stomach
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11
midgut
strong strong
regionalstrong expression: see section 14 15 16 17 18
bladder
strong strong
regionalstrong expression: see section 14
axial skeleton
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13
basioccipital bone
strong strong
regionalstrong expression: see section 07 08 09 13 14
basisphenoid bone
strong strong
regionalstrong expression: see section 13
pelvic girdle skeleton
strong strong
regionalstrong expression: see section 11 12
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1236
Entity Detected:Arhgap12, Rho GTPase activating protein 12 ( MGI:1922665)
Sequence:sense strand is shown

>T1236
CCTCGAGCCTGTTGGCCTACTGGAATAACCAGGTAGCAGAGGCCGATGAAGCAGCTGAAGAGGAAACACC
AGATTCACCAGGGGTAGAAAAGCATGATAAAGAAAAGGACCAGAAGGAGCTTAAAAAACTTCGCTCAATG
AAAGGATCCAGCATGGATTCTTCAGAGCAGAAGAAAACTAAGAAAAACTTAAAGAAGTTTCTTACCCGGC
GCCCCACTTTGCAAGCTGTTCGTGAGAAAGGTTATATCAAAGATCAAGTATTTGGATCTAATCTTGCTAA
TCTGTGTCAGAGGGAGAATGGGACAGTGCCAAAGTTTGTGAAGTTATGCATTGAGCATGTCGAAGAGCAT
GGTTTAGATGTTGATGGTATTTACAGAGTGAGTGGCAACCTTGCCGTGATCCAGAAGCTGAGGTTCGCAG
TCAATCATGTTTTTCAGATGAGAAGTTGGACTTGAATGACAGTAAATGGGAAGACATTCATGTCATCACG
GGAGCACTCAAAATGTTTTTTCGAGAACTACCAGAACCTCTTTTTACGTTTAATCATTTCAATGATTTTG
TTAATGCAATTAA
Notes:The probe template was PCR amplified from IMAGE:2192835 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2192835 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:16544 same embryo
 EMAGE:16546 same embryo
 EMAGE:16547 same embryo
 EurExpress:euxassay_008610 same experiment
 MGI:4823216 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS