Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:166

En2 engrailed 2 ( MGI:95390)
TS15 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:166
Fig 1B (right hand panel) of Bally-Cuif et al., 1992 [PMID:1360404] . Copyright: This image is from Development and is displayed with permission of The Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: three stars
Find spatially similar expression patterns: Find spatially similar patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:166EMAGE:166Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping3D context movie

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
166_voxel_strong_3D_1.wlz
166_voxel_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:166_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
future midbrain
detected detected
gradedExpression encircling neural tube in met-mesencephalic region, corresponding to presumptive cerebellum, isthmus and colliculi; highest expression at constriction and rostrally; decreases rostrally and caudally.
future hindbrain
detected detected
gradedExpression encirclin neural tube in met-mesencephalic region, corresponding to presumptive cerebellum, isthmus and colliculi; highest expression at constriction and rostrally; decreases rostrally and caudally.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1331401
Entity Detected:En2, engrailed 2 ( MGI:95390)
Sequence:sense strand is shown

>MGI:1331401
AGATCTTTCTTTCATTTTTCTTTTCTCCCTTTTTTTAATCCCTTAAACTCCTTATGGGACATTGGACACT
TCTTCCCCCGAAAGAAAAAAAATTTAAAACAACTTGCTGAAGTCCAAAGATTTTTATTGCTGCATTTCAC
AGGACTGTGAACCGAATAAATAGCTCCTATTTGGTCTGTGGGCTCTGCCGCTTGCTTTGTGCTGGCTCGG
ACAGGTACTGTAGGAAGCGCCAGCCAGCGTGGTGATGGGAG
nt 1315 - nt 1565 of NM_010134.1
Notes:The probe used in this study by Bally-Cuif et al., 1992 [PMID:1360404] was originally described by Davis et al., 1988 [PMID:2454212] as a "250 bp BglII/SstI fragment" within the 3' UTR (see Figure 1 therein).
Chemistry:RNA
Strand:antisense
Label:S35
Specimen
Organism:mouse
Strain:OF1
Age:9.5 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:4% paraformaldehyde
Embedding:paraffin
Staining procedure:autoradiography
General Information
Authors:Bally-Cuif et al., 1992 [PMID:1360404] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:1360404] Bally-Cuif L, Alvarado-Mallart RM, Darnell DK, Wassef M 1992 Relationship between Wnt-1 and En-2 expression domains during early development of normal and ectopic met-mesencephalon. Development (115):999-1009
 [ doi:10.1101/gad.2.3.361] [ PMID:2454212] Davis CA, Noble-Topham SE, Rossant J, Joyner AL 1988 Expression of the homeo box-containing gene En-2 delineates a specific region of the developing mouse brain. Genes Dev (2):361-71
Links:MGI:1935118 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI