EMAGE mouse gene expression spatial database

EMAGE:16770

Mir133a-1 microRNA 133a-1 ( MGI:2676818)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_019317. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_019317_01	euxassay_019317_02	euxassay_019317_03	euxassay_019317_04

euxassay_019317_05	euxassay_019317_06	euxassay_019317_07	euxassay_019317_08	euxassay_019317_09

euxassay_019317_10	euxassay_019317_11	euxassay_019317_12	euxassay_019317_13	euxassay_019317_14

euxassay_019317_15	euxassay_019317_16	euxassay_019317_17	euxassay_019317_18	euxassay_019317_19

euxassay_019317_20	euxassay_019317_21	euxassay_019317_22	euxassay_019317_23	euxassay_019317_24

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Text Annotation:

Structure

Level

Pattern

Notes

vertebral axis musculature

weak

regional

weak expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 19 20 21 22 23 24

tongue muscle

weak

regional

weak expression: see section 11 12 13 14 15 16

Annotation Validation:

spatial mapping by EMAGE editor, text annotation by author

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T70258
Entity Detected:	Mir133a-1, microRNA 133a-1 ( MGI:2676818)
Sequence:	sense strand is shown >T70258 TTTGGTCCCCTTCAACCAGCTG
Notes:	The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-133a was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:	LNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:16771 same assay
	EMAGE:16769 same embryo
	EurExpress:euxassay_019317 same experiment
	MGI:4826211 same experiment
	MGI:4826210 same experiment
	EMAGE:16768 same embryo
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source