Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16810

Meox2 mesenchyme homeobox 2 ( MGI:103219)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16810 EMAGE:16810 EMAGE:16810 EMAGE:16810 EMAGE:16810
"Pseudo-wholemount" of euxassay_008785. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008785_01 euxassay_008785_02 euxassay_008785_03 euxassay_008785_04
EMAGE:16810 EMAGE:16810 EMAGE:16810 EMAGE:16810 EMAGE:16810
euxassay_008785_05 euxassay_008785_06 euxassay_008785_07 euxassay_008785_08 euxassay_008785_09
EMAGE:16810 EMAGE:16810 EMAGE:16810 EMAGE:16810 EMAGE:16810
euxassay_008785_10 euxassay_008785_11 euxassay_008785_12 euxassay_008785_13 euxassay_008785_14
EMAGE:16810 EMAGE:16810 EMAGE:16810 EMAGE:16810 EMAGE:16810
euxassay_008785_15 euxassay_008785_16 euxassay_008785_17 euxassay_008785_18 euxassay_008785_19
EMAGE:16810 EMAGE:16810 EMAGE:16810 EMAGE:16810
euxassay_008785_20 euxassay_008785_21 euxassay_008785_22 euxassay_008785_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16810Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16810_wholemount_strong.wlz
16810_wholemount_moderate.wlz
16810_wholemount_weak.wlz
16810_wholemount_possible.wlz
16810_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16810_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diaphragm
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 weak expression: see section 17 18
forearm mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02
hand mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 21 22 23
hindlimb digit 1 mesenchyme
moderate moderate
regionalmoderate expression: see section 11 14 21 22 23
hindlimb digit 2 mesenchyme
moderate moderate
regionalmoderate expression: see section 11 14 21 22 23
hindlimb digit 3 mesenchyme
moderate moderate
regionalmoderate expression: see section 11 14 21 22 23
hindlimb digit 4 mesenchyme
moderate moderate
regionalmoderate expression: see section 11 14 21 22 23
hindlimb digit 5 mesenchyme
moderate moderate
regionalmoderate expression: see section 22 23
foot mesenchyme
moderate moderate
regionalmoderate expression: see section 05 06
lower leg rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 02 03 04 05
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 12 13 14 15 16 17 18 19 20 21 23
vibrissa
strong strong
regionalstrong expression: see section 04 05 moderate expression: see section 06 07 21 22 23
cochlea
moderate moderate
regionalmoderate expression: see section 18 19 22 23 weak expression: see section 20
esophagus
moderate moderate
regionalmoderate expression: see section 12 13 14
tongue
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17
stomach
weak weak
regionalweak expression: see section 02 03 04 05 06
palatal shelf
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
metanephros
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 18 19 weak expression: see section 15 16 17
lung
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 weak expression: see section 22 23
axial skeleton
weak weak
regionalweak expression: see section 10 11 14
exoccipital bone
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 17 18 19 20 21
vault of skull
moderate moderate
regionalmoderate expression: see section 22 23
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 20 21 22 23
clavicle
weak weak
regionalweak expression: see section 08 09 10 11 16
tail mesenchyme
strong strong
regionalstrong expression: see section 13 14 15 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2812
Entity Detected:Meox2, mesenchyme homeobox 2 ( MGI:103219)
Sequence:sense strand is shown

>T2812
CTCNAGGNCANAATTCGNNACGAGGTGAGATAGCAGTGAATCTAGACCTCACTGAAAGACAGGTGAAAGT
GTGGTTCCAGAACAGGAGAATGAAGTGGAAGCGGGTCAAAGGGGGACAGCAAGGAGCTGCTGCCCGAGAA
AAGGAACTGGTGAATGTGAAAAAGGGAACGCTTCTTCCGTCAGAGCTGTCAGGAATCGGTGCAGCCACCC
TCCAGCAGACAGGGGACTCACTAGCAAACGAGGACAGCCGCGATAGTGACCACAGCTCTGAGCACGCACA
CTTATGATACCTACAAAGACCAGCTCCATTCTCAGGAAAGCACCATTGTGATGGCAAACCTTACCGAACA
TCGTTTACATGGCAGATGTCTGTGGCAGTGTGGCTTAGTATAATTAAATGCAGGCATCTCGAGTCTGTGT
CTCATGATGGATAGACGGTTTACACTAAGTGCCTTTTATTGAAGATGCTTCCACAGTGAAATTGGAGAAA
GCGAACGTATTCCAAATACACTTGTTCCTATATATGACAGAGAGGGAGATGGATGTTTGCTTTGGCTTGC
ACTGAAAATTAA
Notes:The probe template was PCR amplified from IMAGE:1528058 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1528058 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:BL6/SV129
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:MGI:4826161 same experiment
 EurExpress:euxassay_008785 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS