Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16846

Krt4 keratin 4 ( MGI:96701)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16846 EMAGE:16846 EMAGE:16846 EMAGE:16846 EMAGE:16846
"Pseudo-wholemount" of euxassay_008784. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008784_01 euxassay_008784_02 euxassay_008784_03 euxassay_008784_04
EMAGE:16846 EMAGE:16846 EMAGE:16846 EMAGE:16846 EMAGE:16846
euxassay_008784_05 euxassay_008784_06 euxassay_008784_07 euxassay_008784_08 euxassay_008784_09
EMAGE:16846 EMAGE:16846 EMAGE:16846 EMAGE:16846 EMAGE:16846
euxassay_008784_10 euxassay_008784_11 euxassay_008784_12 euxassay_008784_13 euxassay_008784_14
EMAGE:16846 EMAGE:16846 EMAGE:16846 EMAGE:16846 EMAGE:16846
euxassay_008784_15 euxassay_008784_16 euxassay_008784_17 euxassay_008784_18 euxassay_008784_19
EMAGE:16846 EMAGE:16846
euxassay_008784_20 euxassay_008784_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16846Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16846_wholemount_strong.wlz
16846_wholemount_moderate.wlz
16846_wholemount_weak.wlz
16846_wholemount_possible.wlz
16846_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16846_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 10 11 13 14
epidermis
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
vibrissa
strong strong
regionalstrong expression: see section 03 04 05 06 07 18 19 20 not examined expression: see section 12
cornea epithelium
strong strong
regionalstrong expression: see section 01 02 03 04 20 21
naris
strong strong
regionalstrong expression: see section 10 11 13 14
nasal cavity respiratory epithelium
strong strong
regionalstrong expression: see section 10 14
esophagus
strong strong
regionalstrong expression: see section 11 12
rectum
moderate moderate
regionalmoderate expression: see section 12
lower jaw incisor
strong strong
regionalstrong expression: see section 09 10 11 14 15
lower jaw molar
strong strong
regionalstrong expression: see section 07 08 16 17 18
oral epithelium
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
upper jaw incisor
strong strong
regionalstrong expression: see section 10 13 14 not examined expression: see section 15
upper jaw molar
strong strong
regionalstrong expression: see section 07 18
bladder
strong strong
regionalExpression in the fundus region.
urethra of male
strong strong
regionalstrong expression: see section 12
trachea
moderate moderate
regionalmoderate expression: see section 12 13
nucleus pulposus
strong strong
regionalstrong expression: see section 11 12
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1268
Entity Detected:Krt4, keratin 4 ( MGI:96701)
Sequence:sense strand is shown

>T1268
CCTCGAGNCTGTTGGCCTACTGGATTCAGGATCTGGCCTTTGCTTCGCTTCTGTTCTAAGCTCGTTGCAG
CTGCTTCCTCTCTCAGCCATGATCGCCAGACAGTCAAGTGTCCGCGGAGCCTCCCGGGGCTTTAGCAGTG
GCTCAGCTATTGCTGGTGGTGTCAAGCGAGTGGCCTTTAGCTCAGGCTCCATGTCTGGCGGTGCAGGGCG
CTGCTCTTCTGGGGGCTTCGGCAGCAGAAGTCTTTACAACCTCGGGGGTCACAAGAGTATCTCCATGAGC
GTGGCTGGGTCCTGCCAAGGCGGCGGCTATGGGGGTGCCGGAGGCTTCGGCGTTGGAGGATACGGTGCTG
GGTTTGGTGCCGGTGGTTTTGGCGGTGGCTTTGGAGGCTCCTTCAACGGTCGAGGAGATCCTGGCTTCCC
AGTCTGTCCTGCTGGAGGTATTCAGGAAGTCACCATCAACCAGAGCCTGCTGACACCTCTTCAGGTGGAG
ATTGACCCAGAGATCCAGAAAATCCGCACGGCGGAGCGTGAGCAGATCAAGACCCTCAACAACAAATTCG
CGCCCTTCATCGATAAGGTGCG
Notes:The probe template was PCR amplified from IMAGE:2225645 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2225645 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:16848 same embryo
 EMAGE:16845 same embryo
 EMAGE:16849 same embryo
 EMAGE:16844 same embryo
 EMAGE:16847 same embryo
 EurExpress:euxassay_008784 same experiment
 MGI:4825839 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS