Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16921

Fkbp11 FK506 binding protein 11 ( MGI:1913370)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16921 EMAGE:16921 EMAGE:16921 EMAGE:16921 EMAGE:16921
"Pseudo-wholemount" of euxassay_008734. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008734_01 euxassay_008734_02 euxassay_008734_03 euxassay_008734_04
EMAGE:16921 EMAGE:16921 EMAGE:16921 EMAGE:16921 EMAGE:16921
euxassay_008734_05 euxassay_008734_06 euxassay_008734_07 euxassay_008734_08 euxassay_008734_09
EMAGE:16921 EMAGE:16921 EMAGE:16921 EMAGE:16921 EMAGE:16921
euxassay_008734_10 euxassay_008734_11 euxassay_008734_12 euxassay_008734_13 euxassay_008734_14
EMAGE:16921 EMAGE:16921 EMAGE:16921 EMAGE:16921 EMAGE:16921
euxassay_008734_15 euxassay_008734_16 euxassay_008734_17 euxassay_008734_18 euxassay_008734_19
EMAGE:16921 EMAGE:16921 EMAGE:16921 EMAGE:16921 EMAGE:16921
euxassay_008734_20 euxassay_008734_21 euxassay_008734_22 euxassay_008734_23 euxassay_008734_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16921Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16921_wholemount_strong.wlz
16921_wholemount_moderate.wlz
16921_wholemount_weak.wlz
16921_wholemount_possible.wlz
16921_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16921_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 18 19 20 21 22 moderate expression: see section 07 12 13 14 23 24 weak expression: see section 08 09 10 11
otic capsule
weak weak
regionalweak expression: see section 06 07 08 09 15 16 17
mandible
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 16 17 18 19 20 21 22
lower jaw incisor
strong strong
regionalstrong expression: see section 09 10 14 15 moderate expression: see section 11 12
maxilla
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 16 17 18 19 20 21 22
upper jaw incisor
strong strong
regionalstrong expression: see section 09 10 15 moderate expression: see section 11 12
liver left lobe
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12
liver right lobe
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18 19 20 21 22 23 24
basioccipital bone
moderate moderate
regionalmoderate expression: see section 23 24
exoccipital bone
moderate moderate
regionalmoderate expression: see section 01 03 04 18 19 20 21 22 23 24 weak expression: see section 05
temporal bone
moderate moderate
regionalmoderate expression: see section 03
temporal bone petrous part
moderate moderate
regionalmoderate expression: see section 02 04 20 21 22 23 weak expression: see section 05
temporo-mandibular joint primordium
moderate moderate
regionalmoderate expression: see section 01
orbito-sphenoid
strong strong
regionalstrong expression: see section 02 03 04 05 21 22 23 24 moderate expression: see section 01 06 07 08 17 18 19 20
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
clavicle
strong strong
regionalstrong expression: see section 08 15 moderate expression: see section 06 07 14 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2810
Entity Detected:Fkbp11, FK506 binding protein 11 ( MGI:1913370)
Sequence:sense strand is shown

>T2810
TGGCCTCGAGCCAGATTCGGCACGAGGCGCGTGCACCCGAACAGCCTGCCCTGGTATCCTGGTGCTCTGA
CCCGGTCCAATCATGACCCTGAGCCCTTTGCTCCTACCACTCCAGCTGTTACTGCTGCTACTGTTCAGTG
GGGCGGTGTGCCGGGCTGAGGCTGGGCCAGAAACCGAAAGTCCTGTCCGGACCCTCCAAGTGGAGACCCT
GGTGCAGCCCCCTGAATCGTGCACGGAATCTGCTGCCATTGGAGACACGCTCCACATACACTACACGGGC
AGTTTGGTAGATGGACGCATTATTGACACTTCTCTGACCAGAGATCCTCTGGTCATAGAACTCGGCCAAA
AGCAGGTGATTCCAGGTCTGGAGCAGAGCCTTTTGGACATGTGTGTGGGAGAGAAGCGAAGAGCAGTCAT
TCCTTCTCACCTGGCTTATGGAAAGCGAGGGTACCCGCCATCTATCCCAGCCGATGCAGTGGTGCAGTAC
GATGTGGAGCTGATCGCTTTGATTCGAGCCAACTACTGGCAGAAGCTGCTAAAGAGCATTTTGCCTCTGG
TAGG
Notes:The probe template was PCR amplified from IMAGE:1527946 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1527946 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:16920 same embryo
 EMAGE:16922 same embryo
 EMAGE:16919 same embryo
 EMAGE:16923 same embryo
 EMAGE:16918 same embryo
 EurExpress:euxassay_008734 same experiment
 MGI:4824868 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS