Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17030

Cflar CASP8 and FADD-like apoptosis regulator ( MGI:1336166)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17030 EMAGE:17030 EMAGE:17030 EMAGE:17030 EMAGE:17030
"Pseudo-wholemount" of euxassay_001440. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_001440_01 euxassay_001440_02 euxassay_001440_03 euxassay_001440_04
EMAGE:17030 EMAGE:17030 EMAGE:17030 EMAGE:17030 EMAGE:17030
euxassay_001440_05 euxassay_001440_06 euxassay_001440_07 euxassay_001440_08 euxassay_001440_09
EMAGE:17030 EMAGE:17030 EMAGE:17030 EMAGE:17030 EMAGE:17030
euxassay_001440_10 euxassay_001440_11 euxassay_001440_12 euxassay_001440_13 euxassay_001440_14
EMAGE:17030 EMAGE:17030 EMAGE:17030 EMAGE:17030 EMAGE:17030
euxassay_001440_15 euxassay_001440_16 euxassay_001440_17 euxassay_001440_18 euxassay_001440_19
EMAGE:17030 EMAGE:17030 EMAGE:17030 EMAGE:17030 EMAGE:17030
euxassay_001440_20 euxassay_001440_21 euxassay_001440_22 euxassay_001440_23 euxassay_001440_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17030Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17030_wholemount_strong.wlz
17030_wholemount_moderate.wlz
17030_wholemount_weak.wlz
17030_wholemount_possible.wlz
17030_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17030_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
limb
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 19 20 21 22 23 24
foregut-midgut junction
weak weak
regionalweak expression: see section 13 14
hypothalamus mantle layer
moderate moderate
regionalmoderate expression: see section 11 12 13 weak expression: see section 09 10 14 15 16 17
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 11 12 13 weak expression: see section 08 09 10 14 15 16 17 18
lateral ventricle choroid plexus
strong strong
regionalstrong expression: see section 07 08 09 10 11 13 14 15 16 17 18 19 20
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 21 22 23 24 weak expression: see section 10 11 18 19 20
olfactory cortex marginal layer
weak weak
regionalweak expression: see section 13 15
olfactory cortex ventricular layer
weak weak
regionalweak expression: see section 12 16 17
4th ventricle lateral recess
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 17 18 19 20 21 22
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17
pons mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain mantle layer
weak weak
regionalweak expression: see section 06 08 09 10 11 12 13 14 15 16 17 18
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 19 20
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 17 18 19 20 21 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07 16 17
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 08 09 14
cervical ganglion
moderate moderate
regionalmoderate expression: see section 08
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 09 10 11
stomach
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07
hindgut
weak weak
regionalweak expression: see section 10 13
midgut
moderate moderate
regionalmoderate expression: see section 15 16 weak expression: see section 06 07 08 09 10 11 12 13 14
axial skeleton
moderate moderate
regionalmoderate expression: see section 09 10 11 12
tail dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2817
Entity Detected:Cflar, CASP8 and FADD-like apoptosis regulator ( MGI:1336166)
Sequence:sense strand is shown

>T2817
GNCCTCNAGNCAGATTCGGCACGAGGGAATTTGTTAGAAANTGCCTGAAGAACATCCACAGAATAGACTT
GAACACAAAGATCCAGAAGTACACCCAGTCCAGCCAAGGAGCAAGATCAAATATGAATACTCTCCAGGCT
TCGCTCCCAAAATTGAGTATCAAGTATAACTCAAGGGTGAGTCTGGAGCCAGTGTATGGAGTACCAGCAT
GAACCAGTCTCAGAGATGTAATAAAAATAAACATCTCATTTCATATGCTGTAATAGCTAAACAAATTCTG
ATAGATATGTGTTTGATTAAGAATGTGTATAATTTCTTATGATTATAAACCTTAGTAGTGTTCAAAAATA
TATTTGGAAAAATTTATGAAATATATAACAAGAAAATAATTTTTGTGCCCATTATCTGGGCATGACTACT
GTGGAAAGCTTTCTTTTAGTCTCTGTCCTATGTGCATTAGCAAATGTGTCTATTTATACAGTTGAATATC
TTTTTCATTCTTTGTTTCTTTGAAGAGTCAATTTTAAAAATTAAAGTAGGTAGAATGTACCCATAGAAAG
AAAAAGTTAAATGT
Notes:The probe template was PCR amplified from IMAGE:1528203 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1528203 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:MGI:4823828 same experiment
 EurExpress:euxassay_001440 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS