Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17668

Sox8 SRY-box containing gene 8 ( MGI:98370)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17668 EMAGE:17668 EMAGE:17668 EMAGE:17668 EMAGE:17668
"Pseudo-wholemount" of euxassay_006002. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_006002_01 euxassay_006002_02 euxassay_006002_03 euxassay_006002_04
EMAGE:17668 EMAGE:17668 EMAGE:17668 EMAGE:17668 EMAGE:17668
euxassay_006002_05 euxassay_006002_06 euxassay_006002_07 euxassay_006002_08 euxassay_006002_09
EMAGE:17668 EMAGE:17668 EMAGE:17668 EMAGE:17668 EMAGE:17668
euxassay_006002_10 euxassay_006002_11 euxassay_006002_12 euxassay_006002_13 euxassay_006002_14
EMAGE:17668 EMAGE:17668 EMAGE:17668 EMAGE:17668 EMAGE:17668
euxassay_006002_15 euxassay_006002_16 euxassay_006002_17 euxassay_006002_18 euxassay_006002_19
EMAGE:17668 EMAGE:17668 EMAGE:17668 EMAGE:17668 EMAGE:17668
euxassay_006002_20 euxassay_006002_21 euxassay_006002_22 euxassay_006002_23 euxassay_006002_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17668Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17668_wholemount_strong.wlz
17668_wholemount_moderate.wlz
17668_wholemount_weak.wlz
17668_wholemount_possible.wlz
17668_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17668_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diaphragm
strong strong
regionalstrong expression: see section 17 18 19 20 21 22 23 24 moderate expression: see section 01 02 03 04 05 06 07 08 09 11 16
forearm mesenchyme
strong strong
regionalstrong expression: see section 01 02
shoulder mesenchyme
strong strong
regionalstrong expression: see section 01 02
hand mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 22 23 24
hindlimb digit 1 metatarsal
strong strong
regionalstrong expression: see section 05 06 08 23 24
hindlimb digit 2 metatarsal
strong strong
regionalstrong expression: see section 05 06 07 08 23 24
hindlimb digit 3 metatarsal
strong strong
regionalstrong expression: see section 05 06 07 08 23 24
hindlimb digit 4 metatarsal
strong strong
regionalstrong expression: see section 05 06 07 08 23 24
hindlimb digit 5 metatarsal
strong strong
regionalstrong expression: see section 05 06
foot mesenchyme
strong strong
regionalstrong expression: see section 03 04 05 08 23 24
knee mesenchyme
strong strong
regionalstrong expression: see section 03
upper leg mesenchyme
strong strong
regionalstrong expression: see section 01 02 03
head mesenchyme
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 19 20 21 22 23 24
vertebral axis musculature
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 14 15 16 17 18 19 20 21 22 23 24 moderate expression: see section 01
hypothalamus mantle layer
strong strong
single cellstrong expression: see section 08 09 10 11 12 15 16 17 18
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 13 14 15
diencephalon lateral wall mantle layer
strong strong
single cellstrong expression: see section 08 09 10 11 12 15 16 17
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 13 14 15
corpus striatum
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 20 21 22 23 24
olfactory cortex ventricular layer
strong strong
homogeneousstrong expression: see section 12 13 17 18 not examined expression: see section 14
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 16 17 18 19 20 21 22 23 24
medulla oblongata basal plate mantle layer
moderate moderate
single cellmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 14 18 19 20 21 22
pons mantle layer
moderate moderate
single cellmoderate expression: see section 06 07 08 09 10 11 12 14 15 16 18 19 20
pons ventricular layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
midbrain mantle layer
strong strong
single cellstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
not examined not examined
single cellnot examined expression: see section 06
midbrain ventricular layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17
ventral grey horn
moderate moderate
single cellmoderate expression: see section 08 09 10 11 12 13 14
otic capsule
moderate moderate
regionalmoderate expression: see section 01 02 04 08 09 16 17 18 19 20 21 22 23 24 weak expression: see section 05 06 07
nasal capsule
strong strong
regionalstrong expression: see section 12 13 14 15 16 17
viscerocranium
strong strong
regionalExpression in the turbinate bone.
esophagus
moderate moderate
regionalmoderate expression: see section 11 12
tongue mesenchyme
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16
stomach
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 weak expression: see section 01 02
hindgut
moderate moderate
regionalmoderate expression: see section 14 15 16
rectum
moderate moderate
regionalmoderate expression: see section 13
midgut
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18
lower jaw incisor
strong strong
regionalstrong expression: see section 12 13 14 15 16
lower jaw molar
strong strong
regionalstrong expression: see section 19 20
upper jaw incisor
strong strong
regionalstrong expression: see section 11 12 13 16 17
upper jaw molar
strong strong
regionalstrong expression: see section 19 20
maturing glomerular tuft
strong strong
regionalstrong expression: see section 06 07 08 09 15 16 17 18 19
laryngeal cartilage
moderate moderate
regionalmoderate expression: see section 12 13
trachea
moderate moderate
regionalmoderate expression: see section 12 13
axial skeleton
moderate moderate
regionalmoderate expression: see section 11 12 13 14
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T165
Entity Detected:Sox8, SRY-box containing gene 8 ( MGI:98370)
Sequence:sense strand is shown

>T165
GTCCGTCCACAGAGTGACCGGGCGCGACCCCTGCGTCCATCCCCACTGAGTGCCCCTCCGCGCGTGGCCC
CGATGCTGGACATGAGTGAGGCCCGCGCCCAGCCTCCCTGCAGCCCGTCTGGCACCGCTAGCTCCATGTC
ACACGTGGAGGATTCGGACTCCGATGCGCCACCGTCGCCCGCGGGATCAGAGGGCCTGGGCCGCGCGGGG
GGCGGCGGCCGAGGGGATACTGCTGAGGCAGCAGACGAACGCTTCCCAGCCTGCATCCGTGATGCCGTGT
CGCAGGTGCTTAAGGGCTATGACTGGAGTCTGGTGCCTATGCCTGTGCGCGGCGGCGGTGGCGGCACGCT
CAAGGCCAAGCCACACGTGAAGCGGCCCATGAATGCCTTCATGGTGTGGGCACAGGCGGCGCGCCGCAAG
CTGGCGGACCAGTACCCGCATCTCCATAACGCAGAGCTCAGCAAGACCCTAGGCAAGCTGTGGCGCTTGC
TGAGT
Notes:The probe template was PCR amplified from IMAGE:2645295 using vector specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2645295 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17670 same embryo
 EMAGE:17669 same embryo
 EurExpress:euxassay_006002 same experiment
 MGI:4828393 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS