EMAGE mouse gene expression spatial database

EMAGE:17694

Cel carboxyl ester lipase ( MGI:88374)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_006019. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_006019_01	euxassay_006019_02	euxassay_006019_03	euxassay_006019_04

euxassay_006019_05	euxassay_006019_06	euxassay_006019_07	euxassay_006019_08	euxassay_006019_09

euxassay_006019_10	euxassay_006019_11	euxassay_006019_12	euxassay_006019_13	euxassay_006019_14

euxassay_006019_15	euxassay_006019_16	euxassay_006019_17	euxassay_006019_18	euxassay_006019_19

euxassay_006019_20	euxassay_006019_21

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Text Annotation:

Structure

Level

Pattern

Notes

pancreas

strong

regional

strong expression: see section 07 08 09 10 11 12 13

Annotation Validation:

spatial mapping by EMAGE editor, text annotation by author

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T302
Entity Detected:	Cel, carboxyl ester lipase ( MGI:88374)
Sequence:	sense strand is shown >T302 CTCACCATGGGGCGCCTGGAGGTTCTATTTCTTGGCCTCACCTGCTGCTTGGCAGCGGCTTGTGCTGCAA AGTTGGGGGCTGTGTACACAGAAGGCGGTTTCGTGGAGGGCGTCAACAAGAAGCTCAGTCTCTTGGGTGG TGACTCTGTTGACATCTTCAAGGGCATCCCCTTTGCCACTGCCAAGACCTTGGAGAATCCTCAGCGTCAC CCTGGCTGGCAAGGGACGCTGAAGGCTACAAACTTCAAGAAACGATGCCTACAGGCCACCATCACCCAGG ACAACACCTATGGGCAAGAAGACTGCCTCTACCTCAATATCTGGGTGCCCCAGGGCAGGAAGCAGGTGTC CCACAACCTGCCTGTGATGGTCTGGATCTATGGAGGTGCCTTCCTCATGGGATCTGGCCAAGGGGCCAAT TTTCTCAAAAACTACCTGTATGACGGGGAGGAGATCGCCACTCGGGGCAACGTCATTGTGGTCACCTTCA ACTACCGGTGTT
Notes:	The probe template was PCR amplified from IMAGE:2812085 using vector specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2812085 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:17695 same embryo
	EMAGE:17693 same embryo
	EMAGE:17692 same embryo
	EMAGE:17696 same embryo
	EurExpress:euxassay_006019 same experiment
	MGI:4823800 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source