Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17766

Gli1 GLI-Kruppel family member GLI1 ( MGI:95727)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17766 EMAGE:17766 EMAGE:17766 EMAGE:17766 EMAGE:17766
"Pseudo-wholemount" of euxassay_008919. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008919_01 euxassay_008919_02 euxassay_008919_03 euxassay_008919_04
EMAGE:17766 EMAGE:17766 EMAGE:17766 EMAGE:17766 EMAGE:17766
euxassay_008919_05 euxassay_008919_06 euxassay_008919_07 euxassay_008919_08 euxassay_008919_09
EMAGE:17766 EMAGE:17766 EMAGE:17766 EMAGE:17766 EMAGE:17766
euxassay_008919_10 euxassay_008919_11 euxassay_008919_12 euxassay_008919_13 euxassay_008919_14
EMAGE:17766 EMAGE:17766 EMAGE:17766 EMAGE:17766 EMAGE:17766
euxassay_008919_15 euxassay_008919_16 euxassay_008919_17 euxassay_008919_18 euxassay_008919_19
EMAGE:17766 EMAGE:17766 EMAGE:17766 EMAGE:17766 EMAGE:17766
euxassay_008919_20 euxassay_008919_21 euxassay_008919_22 euxassay_008919_23 euxassay_008919_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17766Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17766_wholemount_strong.wlz
17766_wholemount_moderate.wlz
17766_wholemount_weak.wlz
17766_wholemount_possible.wlz
17766_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17766_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 18 19 20 21 22 23
radius
moderate moderate
regionalmoderate expression: see section 23 24
ulna
moderate moderate
regionalmoderate expression: see section 24
humerus
weak weak
regionalweak expression: see section 01 02 03 04 20 21 22 23 24
hand
moderate moderate
regionalmoderate expression: see section 01 02 17 18 19 20 22 23 weak expression: see section 21
hindlimb digit 1 metatarsal
moderate moderate
regionalmoderate expression: see section 24
hindlimb digit 1 phalanx
moderate moderate
regionalmoderate expression: see section 24
hindlimb digit 2 metatarsal
moderate moderate
regionalmoderate expression: see section 24
hindlimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 24
hindlimb digit 3 metatarsal
moderate moderate
regionalmoderate expression: see section 24
hindlimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 24
hindlimb digit 4 metatarsal
moderate moderate
regionalmoderate expression: see section 23 24
hindlimb digit 4 phalanx
moderate moderate
regionalmoderate expression: see section 22 23 24
hindlimb digit 5 metatarsal
moderate moderate
regionalmoderate expression: see section 23
hindlimb digit 5 phalanx
moderate moderate
regionalmoderate expression: see section 23
fibula
moderate moderate
regionalmoderate expression: see section 01 24
tibia
moderate moderate
regionalmoderate expression: see section 01 24
femur
moderate moderate
regionalmoderate expression: see section 03 04 05 08 weak expression: see section 19 20 21 22
vibrissa
moderate moderate
regionalmoderate expression: see section 03 04 05 06 19 20 21
hypothalamus ventricular layer
weak weak
regionalweak expression: see section 11 12 13
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 11 12 13
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 04 05 17 19 weak expression: see section 06 08 09 10 15 16 20 21
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 21 22 23
esophagus
moderate moderate
regionalmoderate expression: see section 12 13 weak expression: see section 14
stomach
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08
midgut
moderate moderate
regionalmoderate expression: see section 06 07 08 10 11 12
mandible
moderate moderate
regionalmoderate expression: see section 02 03 04 19 20 21 22 weak expression: see section 05 07 08 09 10 15 16 17 18
maxilla
moderate moderate
regionalmoderate expression: see section 03 04 19 20 weak expression: see section 05 07 08 09 10 15 16 17 18
axial skeleton
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 02 03 04 20 21 22 23 24 weak expression: see section 05 19
clavicle
moderate moderate
regionalmoderate expression: see section 07 08 09 10 15 16 17
scapula
weak weak
regionalweak expression: see section 03 04 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35450
Entity Detected:Gli1, GLI-Kruppel family member GLI1 ( MGI:95727)
Sequence:sense strand is shown

>T35450
GCATGAGCTCTGCTTACACAGTCAGCCGCAGGTCCTCCCTGGCATCCCCTTTACCGACTGGAACCCCACC
AGAGAATGGGGCATCGTCACTACCTGGCCTCACACCTGCTCAGCACTACATGCTCCGTGCCAGATATGCT
TCAGCCAGGGGGAGTGGCACCCCGCCCACTGCAGCTCACAGCCTGGATCGGATGGGAGGTCTTTCTGTTC
CTCCTTGGAGAAGCCGAACCGAGTACCCGGGATACAACCCAAATGCAGGGGTCACTCGGAGGGCCAGTGA
CCCAGCCCGGGCTGCTGACCACCCAGCTCCAGCCAGAGTCCAGCGGTTCAAGAGCCTGGGATGTGTCCAC
ACGCCCCCTAGTGTGGCAACGGGACGGAACTTCGATCCCCACCACCCTACCTCTGTCTATTCGCCACAGC
CCCCCAGCATCACCGAAAATGTTGCCATGGATACTAGGGGGCTACAGGAGGATCCAGAGGTTGGAACTTC
TGTGATGGGCAATGGTCTGAACCCATACATGGATTTTTCCTCCACTGATACTCTGGGATATGGGGGACCC
GAGGGGACGGCAGCTGAGCCTTATGAAGCTAGGGGTCCAGGTTCCCTGCCTCTTGGGCCTGGTCCACCAA
CCAACTAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 100989. Forward Primer - name:100989_F_cDNA_Gli, sequence:GCATGAGCTCTGCTTACACAGT; Reverse Primer - name:100989_N_SP6_cDNA_Gli, sequence:ATAGTTGGTTGGTGGACCAGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17765 same embryo
 EMAGE:17763 same embryo
 EMAGE:17764 same embryo
 EurExpress:euxassay_008919 same experiment
 MGI:4825071 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS