Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17802

Nrarp Notch-regulated ankyrin repeat protein ( MGI:1914372)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17802 EMAGE:17802 EMAGE:17802 EMAGE:17802 EMAGE:17802
"Pseudo-wholemount" of euxassay_008969. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008969_01 euxassay_008969_02 euxassay_008969_03 euxassay_008969_04
EMAGE:17802 EMAGE:17802 EMAGE:17802 EMAGE:17802 EMAGE:17802
euxassay_008969_05 euxassay_008969_06 euxassay_008969_07 euxassay_008969_08 euxassay_008969_09
EMAGE:17802 EMAGE:17802 EMAGE:17802 EMAGE:17802 EMAGE:17802
euxassay_008969_10 euxassay_008969_11 euxassay_008969_12 euxassay_008969_13 euxassay_008969_14
EMAGE:17802 EMAGE:17802 EMAGE:17802 EMAGE:17802 EMAGE:17802
euxassay_008969_15 euxassay_008969_16 euxassay_008969_17 euxassay_008969_18 euxassay_008969_19
EMAGE:17802 EMAGE:17802 EMAGE:17802 EMAGE:17802 EMAGE:17802
euxassay_008969_20 euxassay_008969_21 euxassay_008969_22 euxassay_008969_23 euxassay_008969_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17802Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17802_wholemount_strong.wlz
17802_wholemount_moderate.wlz
17802_wholemount_weak.wlz
17802_wholemount_possible.wlz
17802_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17802_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
thymus primordium
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16
epidermis
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
vibrissa
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 21 22 23 24
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
medulla oblongata alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 13 14
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 12
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 13 14 15 16
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 02 03 23
metanephros
moderate moderate
regionalmoderate expression: see section 18 19 20 21 22
renal cortex
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35508
Entity Detected:Nrarp, Notch-regulated ankyrin repeat protein ( MGI:1914372)
Sequence:sense strand is shown

>T35508
TGGAAATCGGGCTAAGTCTCTACGTCCGCGGCCACGACCAAAGTAGCGCATCCGTGGACCCCAGGGTTCG
GCTCTCCGCAAAAGAGCGCCTCCCCTTGGCAGTCCTCTGAGCCCCGCGGGGCCCCAGAGCCTTCCCACGG
CCCCGACCGCCTAGAGGGTGGGGGCGGGGCGCAGGCTCCAGTCCGTTTTGAAATTTGAGTCTCACACCGG
GAGACTTCGGAATCCCGAGATACCGGATCCTCCGCTTGAAATGTTTTCTCCGGAAGGTGAAAGGCGCGGG
CGGACTCGCGCTCCAGCCGCCGCTCGTGAGACCCGGCCGCTCACAGTGCGGCGCCCGCCGCTGGCAGCCG
CCAAACAACCATTACCGGGCTCCACCATCTGCGCGCCCTCGCACTTAGGAAGGGAAGGGGACGCTCCGGG
TTCCTGATGTCCTCAACTATTTATCACGTGTGTGTATATTTGTGGGTGAAGTTTGTGCGCCTGAGTTTTT
TGTTTGGAAATATTGTGCGTGGTTATGGGAGAAAGATGCATTTTTTTTCCTTTAAAACTAAAAACTTGAG
TCTACCATTTTTTGGTTGCACTGAAAATACCGCCTAGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 64815. Forward Primer - name:064815_F_cDNA_Nrarp, sequence:TGGAAATCGGGCTAAGTCTCTA; Reverse Primer - name:064815_N_SP6_cDNA_Nrarp, sequence:GCTAGGCGGTATTTTCAGTGC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17801 same embryo
 EurExpress:euxassay_008969 same experiment
 MGI:4826789 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS