Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17818

Ckm creatine kinase, muscle ( MGI:88413)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17818 EMAGE:17818 EMAGE:17818 EMAGE:17818 EMAGE:17818
"Pseudo-wholemount" of euxassay_009018. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009018_01 euxassay_009018_02 euxassay_009018_03 euxassay_009018_04
EMAGE:17818 EMAGE:17818 EMAGE:17818 EMAGE:17818 EMAGE:17818
euxassay_009018_05 euxassay_009018_06 euxassay_009018_07 euxassay_009018_08 euxassay_009018_09
EMAGE:17818 EMAGE:17818 EMAGE:17818 EMAGE:17818 EMAGE:17818
euxassay_009018_10 euxassay_009018_11 euxassay_009018_12 euxassay_009018_13 euxassay_009018_14
EMAGE:17818 EMAGE:17818 EMAGE:17818 EMAGE:17818 EMAGE:17818
euxassay_009018_15 euxassay_009018_16 euxassay_009018_17 euxassay_009018_18 euxassay_009018_19

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17818Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17818_wholemount_strong.wlz
17818_wholemount_moderate.wlz
17818_wholemount_weak.wlz
17818_wholemount_possible.wlz
17818_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17818_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diaphragm
strong strong
regionalstrong expression: see section 02 03 04 moderate expression: see section 05 06 07 08 17 18 19
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 17 18 19 moderate expression: see section 08 09 10 11 13 14 15 16
hypothalamus ventricular layer
moderate moderate
homogeneousmoderate expression: see section 11 12 13 14
diencephalon lateral wall ventricular layer
moderate moderate
homogeneousmoderate expression: see section 11 12 13 14
olfactory cortex ventricular layer
moderate moderate
homogeneousmoderate expression: see section 11 12 15 16
telencephalon ventricular layer
moderate moderate
homogeneousmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 14 15 16 17 18 19
medulla oblongata alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 05 07 18 19 weak expression: see section 06
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 08 09 11 12 13 14 15 16 17
facial vii ganglion
weak weak
regionalweak expression: see section 05 06 19
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 07 08
trigeminal v ganglion
weak weak
regionalweak expression: see section 04 05 06 07 08 09 17 18 19
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 07 08
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 11 12 13
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13
dorsal root ganglion
weak weak
regionalweak expression: see section 09 10 15 16
neural retina
moderate moderate
regionalmoderate expression: see section 03 04 05 weak expression: see section 02
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 11 14 15 weak expression: see section 09 10 16 17 18
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 11 14
heart ventricle
strong strong
regionalstrong expression: see section 11 12 15 moderate expression: see section 07 08 09 10 13 14 16
esophagus
weak weak
regionalweak expression: see section 11 12
tongue muscle
moderate moderate
regionalmoderate expression: see section 11 weak expression: see section 13 14
stomach
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10
hindgut
weak weak
regionalweak expression: see section 11 12 13
midgut
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36160
Entity Detected:Ckm, creatine kinase, muscle ( MGI:88413)
Sequence:sense strand is shown

>T36160
GAGTCCTACACGGTCTTCAAGGACCTGTTTGATCCCATCATCCAGGACCGCCATGGCGGCTACAAACCCA
CAGACAAGCATAAGACCGACCTCAACCACGAGAACCTCAAGGGTGGAGACGACCTGGACCCCAACTATGT
GCTGAGCAGCCGCGTGCGCACTGGCCGCAGCATCAAGGGTTACACTCTGCCTCCGCACTGCTCCCGTGGA
GAGCGCCGTGCAGTGGAGAAGCTGTCCGTGGAAGCTCTCAACAGCCTGACGGGCGAGTTCAAGGGCAAGT
ACTACCCTCTGAAGAGCATGACGGAGCAGGAACAGCAGCAGCTCATTGATGACCACTTCCTGTTTGACAA
GCCCGTGTCACCTCTGCTGCTGGCCTCAGGCATGGCCCGAGACTGGCCCGATGCCCGTGGCATCTGGCAC
AACGACAACAAAAGCTTCCTTGTGTGGGTGAACGAGGAGGACCACCTCCGCGTGATCTCCATGGAGAAGG
GAGGCAATATGAAGGAGGTTTTCCGCCGCTTCTGCGTGGGCCTGCAGAAGATTGAGGAGATCTTCAAGAA
GGCTGGTCACCCCTTCATGTGGAACGAGCACCTGGGCTACGTGCTCACCTGCCCCTCCAACCTGGGCACC
GGGCTGCGCGGAGGCGTGCACGTGAAGCTGGCGAACCTGAGCAAGCACCCCAAGTTTGAGGAGATTCTCA
CTCGCCTTCGTCTGCAGAAGCGCGGCACAGGTGGCGTGGACACGGCTGCGGTGGGCGCCGTGTTCGACAT
CTCCAACGCCGATCGGCTGGGCTCATCCGAAGTCGAACAGGTGCAGCTGGTGGTGGATGGCGTGAAGCTT
ATG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 97539. Forward Primer - name:097539_F_cDNA_Ckm, sequence:GAGTCCTACACGGTCTTCAAGG; Reverse Primer - name:097539_N_SP6_cDNA_Ckm, sequence:CATAAGCTTCACGCCATCCAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17819 same embryo
 EMAGE:17821 same embryo
 EMAGE:17822 same embryo
 EMAGE:17820 same embryo
 EurExpress:euxassay_009018 same experiment
 MGI:4823889 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS