Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17923

Syn2 synapsin II ( MGI:103020)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17923 EMAGE:17923 EMAGE:17923 EMAGE:17923 EMAGE:17923
"Pseudo-wholemount" of euxassay_011679. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011679_01 euxassay_011679_02 euxassay_011679_03 euxassay_011679_04
EMAGE:17923 EMAGE:17923 EMAGE:17923 EMAGE:17923 EMAGE:17923
euxassay_011679_05 euxassay_011679_06 euxassay_011679_07 euxassay_011679_08 euxassay_011679_09
EMAGE:17923 EMAGE:17923 EMAGE:17923 EMAGE:17923 EMAGE:17923
euxassay_011679_10 euxassay_011679_11 euxassay_011679_12 euxassay_011679_13 euxassay_011679_14
EMAGE:17923 EMAGE:17923 EMAGE:17923 EMAGE:17923 EMAGE:17923
euxassay_011679_15 euxassay_011679_16 euxassay_011679_17 euxassay_011679_18 euxassay_011679_19
EMAGE:17923 EMAGE:17923 EMAGE:17923 EMAGE:17923 EMAGE:17923
euxassay_011679_20 euxassay_011679_21 euxassay_011679_22 euxassay_011679_23 euxassay_011679_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17923Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17923_wholemount_strong.wlz
17923_wholemount_moderate.wlz
17923_wholemount_weak.wlz
17923_wholemount_possible.wlz
17923_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17923_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
weak weak
regionalweak expression: see section 10 11 12 14 15 16
cerebral cortex mantle layer
moderate moderate
regionalmoderate expression: see section 24 weak expression: see section 06 07 08 10 11 12 13 14 17 18 19 20 21 22 23
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 24 weak expression: see section 05 06 07 08 09 20 21 22 23
olfactory cortex marginal layer
weak weak
regionalweak expression: see section 10 11 12 13 16 17 18
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 07 08 10 11 12 14 15
pons mantle layer
weak weak
regionalweak expression: see section 06 07 08 09 10 11 15 16 17 18
midbrain mantle layer
weak weak
regionalweak expression: see section 06 07 08 09 10 11 14 15 16 17 18
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 19 20 weak expression: see section 05 07
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 06 07 17
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 19 20 21 22 weak expression: see section 05 06 07 08 09 17 18
vagus x ganglion
weak weak
regionalweak expression: see section 07 08 15 16
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 06
trigeminal v nerve
weak weak
regionalweak expression: see section 10 17
ventral grey horn
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14 15
lens
strong strong
single cellstrong expression: see section 02 moderate expression: see section 01
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37105
Entity Detected:Syn2, synapsin II ( MGI:103020)
Sequence:sense strand is shown

>T37105
ACCAAGTGGAGGACAGACAACTCATCACTGATCTAGTCATCAGCAAGATGAACCAGCTATTGTCCAGGAC
TCCTGCCCTGTCTCCACAGAGACCTTTAACCACCCAACAGCCACAGAGTGGAACACTTAAGGAACCGGAC
TCCAGCAAGACCCCTCCTCAGCGGCCACCTCCCCAAGGTTGTTTACAGTATATTCTCGACTGTAATGGCA
TTGCAGTAGGTCCAAAACAAGTCCAAGCTTCTTAAAGCGATCAGTAGTTAATTTTCAAAACAGAAAACTT
AAGCCAAAAATAAAAAGAAGAGAAAAGAAAGGAAGGCAGGGAGGGGAGCGGCAGATGCTCCGCAGTACAC
TGCTGTGTCCTCTCAGTGCTGACTGGACTGTTTCTCCTATGCAGTGTCAGCCCCCTGTCTGGTTGTTTAC
CTGTCCCTGTTTGTGCTTGTAATGCTTCTACGTTCTTCTGTATAATGTGTGGTTCCAGGGCTGTTTGTTA
ACAGTGTACAAAAGAATCGTGCCTCTCTTAAGTCCAGTGGGACTGTTTTCTGGGTGGTTTGATCGTGTTT
TTAAAGCATCACATTATGAGGGGTGAGGTCCTAGCCCCTGGGGTGGTTGGGAGAAACAGCCACTACAAAG
AGGCCCAGCTTCTCTCCTCTTCCCTCAGGCTCAGCCTCACCTTCTCGCACTTACCTCCACGAGTGCTTGG
GTCTTCATTGAACTGTGTTTAACTTCCTCCCTGCATGACTAGGGTAAATAGATAGCACTTCTAAGAGATT
TCCAAGGTCTACTTTTCATAGTTCCACCCAGTGAACTTGAAGGCATCCATCTCTTTCTCTATTCG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 102009. Forward Primer - name:102009_F_cDNA_Syn2, sequence:ACCAAGTGGAGGACAGACAACT; Reverse Primer - name:102009_N_SP6_cDNA_Syn2, sequence:CGAATAGAGAAAGAGATGGATGC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17920 same embryo
 EMAGE:17919 same embryo
 EMAGE:17921 same embryo
 EMAGE:17922 same embryo
 EMAGE:17918 same embryo
 EurExpress:euxassay_011679 same experiment
 MGI:4828554 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS