Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17946

Tgm2 transglutaminase 2, C polypeptide ( MGI:98731)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17946 EMAGE:17946 EMAGE:17946 EMAGE:17946 EMAGE:17946
"Pseudo-wholemount" of euxassay_011707. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011707_01 euxassay_011707_02 euxassay_011707_03 euxassay_011707_04
EMAGE:17946 EMAGE:17946 EMAGE:17946 EMAGE:17946 EMAGE:17946
euxassay_011707_05 euxassay_011707_06 euxassay_011707_07 euxassay_011707_08 euxassay_011707_09
EMAGE:17946 EMAGE:17946 EMAGE:17946 EMAGE:17946 EMAGE:17946
euxassay_011707_10 euxassay_011707_11 euxassay_011707_12 euxassay_011707_13 euxassay_011707_14
EMAGE:17946 EMAGE:17946 EMAGE:17946 EMAGE:17946 EMAGE:17946
euxassay_011707_15 euxassay_011707_16 euxassay_011707_17 euxassay_011707_18 euxassay_011707_19
EMAGE:17946 EMAGE:17946 EMAGE:17946 EMAGE:17946 EMAGE:17946
euxassay_011707_20 euxassay_011707_21 euxassay_011707_22 euxassay_011707_23 euxassay_011707_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17946Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17946_wholemount_strong.wlz
17946_wholemount_moderate.wlz
17946_wholemount_weak.wlz
17946_wholemount_possible.wlz
17946_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17946_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
pericardium
strong strong
regionalstrong expression: see section 03 04 05 06 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
greater sac mesothelium
strong strong
regionalstrong expression: see section 07
pleura
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 moderate expression: see section 02
diencephalon meninges
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19
telencephalon meninges
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
hindbrain meninges
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
midbrain meninges
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
spinal cord meninges
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16
otic capsule
moderate moderate
regionalmoderate expression: see section 06 07 08 09 15 16 17
naris
strong strong
regionalstrong expression: see section 12 13 14 15 16
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 09 10 11 16 17 18 19
nasal septum
strong strong
regionalstrong expression: see section 14
viscerocranium
strong strong
regionalExpression in the turbinate bone.
heart ventricle
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
stomach
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10
midgut
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
meckel's cartilage
strong strong
regionalstrong expression: see section 11 12 14
liver
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
urinary system
strong strong
regionalstrong expression: see section 02 03 04
bladder
weak weak
regionalweak expression: see section 14 15
urinary system mesentery
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 moderate expression: see section 16
kidney calyx
weak weak
regionalweak expression: see section 07 08 17
kidney pelvis
moderate moderate
regionalmoderate expression: see section 15
ureter
moderate moderate
regionalmoderate expression: see section 09 10 15
basioccipital bone
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 11 12 14 15 16 17 18 19 20 21 22 23 24
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 11 12 14
temporal bone petrous part
moderate moderate
regionalmoderate expression: see section 01 02 03 04 19 20 21 22 23
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 17 18 19 20 21 22 23 24
clavicle
moderate moderate
regionalmoderate expression: see section 08 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37131
Entity Detected:Tgm2, transglutaminase 2, C polypeptide ( MGI:98731)
Sequence:sense strand is shown

>T37131
CTCTACGAGAAGTACAGCGGGTGCCTGACAGAGTCAAACCTCATCAAGGTGCGGGGCCTTCTCATCGAAC
CAGCTGCCAACAGCTACCTGCTGGCTGAGAGAGATCTCTACCTGGAGAATCCCGAAATCAAGATCCGGGT
CCTGGGAGAACCCAAGCAAAACCGCAAACTGGTGGCTGAGGTGTCCCTGAAGAACCCACTTTCCGATCCC
CTGTATGACTGCATCTTCACTGTGGAGGGGGCTGGCCTGACCAAGGAGCAGAAGTCTGTGGAAGTCTCAG
ACCCGGTGCCAGCGGGCGATTTGGTCAAGGCACGGGTCGACCTGTTCCCGACTGATATTGGCCTCCACAA
GCTGGTGGTGAACTTCCAGTGTGACAAGCTGAAGTCGGTGAAGGGTTACCGGAATGTTATCATCGGCCCG
GCCTAAGGGACCCCTTCCCAGACTCAACCCCACCACCTGCCAACCCCCATTCAACCTGGTCTTTATCCTA
AGATAATGAGCAACTTCACCCCATTCAGGCTGACATGGCTGCCTGGGGCCTCTTCAGAAGACAGTGTACT
TCTGGCCCAATCCTGTTCCTCTGGATCTATTTCCCCATCTGTTCCCTTAGCTGTGAGGAAGGTCCTGTGC
CGACACAGTGGGTACCTGGCAAGGGTA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 101639. Forward Primer - name:101639_F_cDNA_Tgm2, sequence:CTCTACGAGAAGTACAGCGGGT; Reverse Primer - name:101639_N_SP6_cDNA_Tgm2, sequence:TACCCTTGCCAGGTACCCACT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17944 same embryo
 EMAGE:17943 same embryo
 EMAGE:17945 same embryo
 EMAGE:17942 same embryo
 EMAGE:17947 same embryo
 EurExpress:euxassay_011707 same experiment
 MGI:4828685 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS