Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17947

Tgfbi transforming growth factor, beta induced ( MGI:99959)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17947 EMAGE:17947 EMAGE:17947 EMAGE:17947 EMAGE:17947
"Pseudo-wholemount" of euxassay_011706. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011706_01 euxassay_011706_02 euxassay_011706_03 euxassay_011706_04
EMAGE:17947 EMAGE:17947 EMAGE:17947 EMAGE:17947 EMAGE:17947
euxassay_011706_05 euxassay_011706_06 euxassay_011706_07 euxassay_011706_08 euxassay_011706_09
EMAGE:17947 EMAGE:17947 EMAGE:17947 EMAGE:17947 EMAGE:17947
euxassay_011706_10 euxassay_011706_11 euxassay_011706_12 euxassay_011706_13 euxassay_011706_14
EMAGE:17947 EMAGE:17947 EMAGE:17947 EMAGE:17947 EMAGE:17947
euxassay_011706_15 euxassay_011706_16 euxassay_011706_17 euxassay_011706_18 euxassay_011706_19
EMAGE:17947 EMAGE:17947
euxassay_011706_20 euxassay_011706_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17947Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17947_wholemount_strong.wlz
17947_wholemount_moderate.wlz
17947_wholemount_weak.wlz
17947_wholemount_possible.wlz
17947_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17947_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 14 15 16 17 18 19 20 21
humerus
strong strong
regionalstrong expression: see section 01 02 03 04 05 18 19 20 21
forelimb digit 2 phalanx
strong strong
regionalstrong expression: see section 03 04 19 20 21
forelimb digit 3 phalanx
strong strong
regionalstrong expression: see section 01 02 03 04 19 20 21
forelimb digit 4 phalanx
strong strong
regionalstrong expression: see section 01 02 21
forelimb digit 5 phalanx
strong strong
regionalstrong expression: see section 01 02
hindlimb digit 1 metatarsal
strong strong
regionalstrong expression: see section 04 05 06 20 21
hindlimb digit 1 phalanx
strong strong
regionalstrong expression: see section 05 06 20 21
hindlimb digit 2 metatarsal
strong strong
regionalstrong expression: see section 04 05 06 20 21
hindlimb digit 2 phalanx
strong strong
regionalstrong expression: see section 05 06 07 19 20 21
hindlimb digit 3 metatarsal
strong strong
regionalstrong expression: see section 04 05 06 19 20 21
hindlimb digit 3 phalanx
strong strong
regionalstrong expression: see section 05 06 07 08 19 20 21
hindlimb digit 4 metatarsal
strong strong
regionalstrong expression: see section 04 05 06 19 20 21
hindlimb digit 4 phalanx
strong strong
regionalstrong expression: see section 05 06 07 08 19 20 21
hindlimb digit 5 metatarsal
strong strong
regionalstrong expression: see section 04 19 20 21
hindlimb digit 5 phalanx
strong strong
regionalstrong expression: see section 07 08 19 20 21
tarsus
strong strong
regionalstrong expression: see section 03 04
fibula
strong strong
regionalstrong expression: see section 01 02 03 04 05 20 21
tibia
strong strong
regionalstrong expression: see section 01 02 03 04 05 20 21
femur
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 18 19 20 21
head mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 18 19 20 21
vibrissa
moderate moderate
regionalmoderate expression: see section 06 07 08 09 18 19 20
trigeminal v ganglion
strong strong
single cellstrong expression: see section 03 04 05 06 07 08 18 19
inner ear
strong strong
regionalstrong expression: see section 06 07 08 09 16
otic capsule
strong strong
regionalstrong expression: see section 07 17
naris
strong strong
regionalstrong expression: see section 12 13 14 15 16 17
viscerocranium
strong strong
regionalExpression in the turbinate bone.
heart valve
strong strong
regionalstrong expression: see section 10 11 12 13
heart ventricle
strong strong
spottedstrong expression: see section 08 09 10 11 12 13 14 15 16 17
tongue muscle
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16
stomach
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09
rectum
moderate moderate
regionalmoderate expression: see section 13 14
midgut
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
urinary system
strong strong
regionalstrong expression: see section 03 18
metanephros
strong strong
regionalstrong expression: see section 04
renal capsule
strong strong
regionalstrong expression: see section 06 07 08 09 10 moderate expression: see section 16 17
left lung
strong strong
regionalstrong expression: see section 02 04 05 06 07 08 09 10
right lung
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17 18 19 20
trachea cartilaginous ring
strong strong
regionalstrong expression: see section 11 12
axial skeleton
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17
basioccipital bone
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
basisphenoid bone
strong strong
regionalstrong expression: see section 12 13 14
temporal bone petrous part
strong strong
regionalstrong expression: see section 02 03 04 05 18 19 20 21
vault of skull
strong strong
regionalstrong expression: see section 01 02
orbito-sphenoid
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 17 18 19 20 21
clavicle
strong strong
regionalstrong expression: see section 06 07 08 09 10 15 16 17
scapula
strong strong
regionalstrong expression: see section 01 02 03 18 19 20 21
sternum
strong strong
regionalstrong expression: see section 11 12 13 14
pelvic girdle skeleton
strong strong
regionalstrong expression: see section 11 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37130
Entity Detected:Tgfbi, transforming growth factor, beta induced ( MGI:99959)
Sequence:sense strand is shown

>T37130
ACCTGCTAAACAACCACATCCTGAAGTCAGCCATGTGTGCTGAGGCCATTGTAGCTGGAATGTCCATGGA
GACCCTGGGGGGCACCACACTGGAGGTGGGCTGCAGTGGGGACAAGCTCACCATCAACGGGAAGGCTGTC
ATCTCCAACAAAGACATCCTGGCCACCAACGGTGTCATTCATTTCATTGATGAGCTGCTTATCCCAGATT
CAGCCAAGACACTGCTTGAGCTGGCTGGGGAATCTGACGTCTCCACTGCCATTGACATCCTCAAACAAGC
TGGCCTCGATACTCATCTCTCTGGGAAAGAACAGTTGACCTTCCTGGCCCCCCTGAATTCTGTGTTCAAA
GATGGTGTCCCTCGCATCGACGCCCAGATGAAGACTTTGCTTCTGAACCACATGGTCAAAGAACAGTTGG
CCTCCAAGTATCTGTACTCTGGACAGACACTGGACACGCTGGGTGGCAAAAAGCTGCGAGTCTTTGTTTA
TCGAAATAGCCTCTGCATTGAAAACAGCTGCATTGCTGCCCATGATAAGAGGGGACGGTTTGGGACCCTG
TTCACCATGGACCGGATGTTGACACCCCCAATGGGGACAGTTATGGATGTCCTGAAGGGAGACAATCGTT
TTAGCATGCTGGTGGCCGCCATCCAGTCTGCAGGACTCATGGAGATCCTCAACCG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 98704. Forward Primer - name:098704_F_cDNA_Tgfbi, sequence:ACCTGCTAAACAACCACATCCT; Reverse Primer - name:098704_N_SP6_cDNA_Tgfbi, sequence:CGGTTGAGGATCTCCATGAGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17944 same embryo
 EMAGE:17943 same embryo
 EMAGE:17945 same embryo
 EMAGE:17942 same embryo
 EMAGE:17946 same embryo
 EurExpress:euxassay_011706 same experiment
 MGI:4828679 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS