Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18125

Unc5c unc-5 homolog C (C. elegans) ( MGI:1095412)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18125 EMAGE:18125 EMAGE:18125 EMAGE:18125 EMAGE:18125
"Pseudo-wholemount" of euxassay_011939. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011939_01 euxassay_011939_02 euxassay_011939_03 euxassay_011939_04
EMAGE:18125 EMAGE:18125 EMAGE:18125 EMAGE:18125 EMAGE:18125
euxassay_011939_05 euxassay_011939_06 euxassay_011939_07 euxassay_011939_08 euxassay_011939_09
EMAGE:18125 EMAGE:18125 EMAGE:18125 EMAGE:18125 EMAGE:18125
euxassay_011939_10 euxassay_011939_11 euxassay_011939_12 euxassay_011939_13 euxassay_011939_14
EMAGE:18125 EMAGE:18125 EMAGE:18125 EMAGE:18125 EMAGE:18125
euxassay_011939_15 euxassay_011939_16 euxassay_011939_17 euxassay_011939_18 euxassay_011939_19
EMAGE:18125 EMAGE:18125 EMAGE:18125 EMAGE:18125
euxassay_011939_20 euxassay_011939_21 euxassay_011939_22 euxassay_011939_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18125Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18125_wholemount_strong.wlz
18125_wholemount_moderate.wlz
18125_wholemount_weak.wlz
18125_wholemount_possible.wlz
18125_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18125_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
homogeneousmoderate expression: see section 01 weak expression: see section 02 03 04 20 21 22
foot
weak weak
homogeneousweak expression: see section 02 03 04
fibula
weak weak
homogeneousweak expression: see section 01 02
tibia
weak weak
homogeneousweak expression: see section 01 02
femur
weak weak
homogeneousweak expression: see section 01 02 03 04 05
diencephalon lateral wall mantle layer
weak weak
regionalweak expression: see section 11 12 14 15
medulla oblongata alar plate mantle layer
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 14 15 16
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 14 15 16
rest of cerebellum mantle layer
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 12 13 15 16 17 18
rest of cerebellum marginal layer
weak weak
regionalweak expression: see section 03 18 19 20
pons mantle layer
weak weak
regionalweak expression: see section 07 14 15
ventral grey horn
moderate moderate
regionalmoderate expression: see section 08 12 13
naris
moderate moderate
homogeneousmoderate expression: see section 11 12
nasal septum
moderate moderate
homogeneousmoderate expression: see section 13
viscerocranium
moderate moderate
homogeneousExpression in the turbinate bone.
lower lip
moderate moderate
regionalmoderate expression: see section 12 13
upper lip
moderate moderate
regionalmoderate expression: see section 12 13 15
metanephros
weak weak
regionalweak expression: see section 07 08 15 16
left lung
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10
right lung
weak weak
regionalweak expression: see section 12 13 14 15 16 17 18 19 20
axial skeleton
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14
basioccipital bone
moderate moderate
homogeneousmoderate expression: see section 02 03 04 05 07 08 14 15 16 17 18 19 20 21 22 23
basisphenoid bone
moderate moderate
homogeneousmoderate expression: see section 06 09 10 11 12 13 14 15
temporal bone petrous part
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 19 20 21 22
vault of skull
moderate moderate
homogeneousmoderate expression: see section 01
orbito-sphenoid
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 19 20
pelvic girdle skeleton
weak weak
homogeneousweak expression: see section 09
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37193
Entity Detected:Unc5c, unc-5 homolog C (C. elegans) ( MGI:1095412)
Sequence:sense strand is shown

>T37193
GAGGCCTATTTAATTGTGGCTGGGGTATCCTCAGGACAAATAGATGCACTCCATAAATATACTAGCAGGC
AAAGCCAAAGAGATGTAAGTGGCGACCTGCAAGTCTTCAGTATACTAAACTTTATATGAAGGTATCTATC
CCAAGAGTACCAAAATGCTACATTGGAAACCCTTGCCATATATCAGGACAGTCATGGCCAAACCCACTAG
TTACTAAGCAGAAAACCAGAGAGTGTCCTGAAATACAATCAGCTGTCCACCAGCCATGTTATTTGCTATG
GTACACCAGCTTTTTATATATCATTTGGGAACCTGTGCTATGGCAGAATTATAAATTGCAGGTAAAATTA
CTGTAAAACCCATTTTAAATAAGCCTAAACCCCATACCATCTTTATATGCCAAAGGCCTAATGCCATGGA
GCCTGATGACCCGTGGCCATGGTGACTGTCAACTGTGGGCTAGTTGTCTTGATGGGCAGCCTAAGGGATG
AGCTCTCTGCCTTTGATCTTCACTCAGTGATGATGTGGCAACATCAAAGCATCCTGATGAGCTCTGTGCT
GTATTAAACCCATTTAAAGATAGCATTCCAAACAAATCCACAGCTAGTAGAAAATGCCTTTGCCCATTTC
TGTGTTCCTAAAGAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 98789. Forward Primer - name:098789_F_cDNA_Unc5c, sequence:GAGGCCTATTTAATTGTGGCTG; Reverse Primer - name:098789_N_SP6_cDNA_Unc5c, sequence:GTCTTTAGGAACACAGAAATGGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18122 same embryo
 EMAGE:18126 same embryo
 EMAGE:18123 same embryo
 EMAGE:18124 same embryo
 EurExpress:euxassay_011939 same experiment
 MGI:4829102 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS