Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18196

C77370 expressed sequence C77370 ( MGI:2148050)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18196 EMAGE:18196 EMAGE:18196 EMAGE:18196 EMAGE:18196
"Pseudo-wholemount" of euxassay_011971. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011971_01 euxassay_011971_02 euxassay_011971_03 euxassay_011971_04
EMAGE:18196 EMAGE:18196 EMAGE:18196 EMAGE:18196 EMAGE:18196
euxassay_011971_05 euxassay_011971_06 euxassay_011971_07 euxassay_011971_08 euxassay_011971_09
EMAGE:18196 EMAGE:18196 EMAGE:18196 EMAGE:18196 EMAGE:18196
euxassay_011971_10 euxassay_011971_11 euxassay_011971_12 euxassay_011971_13 euxassay_011971_14
EMAGE:18196 EMAGE:18196 EMAGE:18196 EMAGE:18196 EMAGE:18196
euxassay_011971_15 euxassay_011971_16 euxassay_011971_17 euxassay_011971_18 euxassay_011971_19
EMAGE:18196 EMAGE:18196 EMAGE:18196
euxassay_011971_20 euxassay_011971_21 euxassay_011971_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18196Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18196_wholemount_strong.wlz
18196_wholemount_moderate.wlz
18196_wholemount_weak.wlz
18196_wholemount_possible.wlz
18196_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18196_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 05 06 07 weak expression: see section 01 02 03 04 08
humerus
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04
hindlimb digit 2 phalanx
weak weak
homogeneousweak expression: see section 02
hindlimb digit 3 phalanx
weak weak
homogeneousweak expression: see section 02
tarsus
weak weak
homogeneousweak expression: see section 03
fibula
moderate moderate
homogeneousmoderate expression: see section 01
tibia
moderate moderate
homogeneousmoderate expression: see section 01 weak expression: see section 02
femur
moderate moderate
homogeneousmoderate expression: see section 01 05 06 21 weak expression: see section 02 04
brain
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 weak expression: see section 01 02 03 04
spinal cord
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17
neural retina
moderate moderate
regionalmoderate expression: see section 01 weak expression: see section 02 03 04
naris
moderate moderate
homogeneousmoderate expression: see section 12 13 weak expression: see section 17
nasal septum
weak weak
homogeneousweak expression: see section 14
viscerocranium
moderate moderate
homogeneousExpression in the turbinate bone.
meckel's cartilage
weak weak
homogeneousweak expression: see section 03 04 05 08 09 10 11 13 14 15 16 17 18
axial skeleton
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15 16 17
basioccipital bone
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 19 weak expression: see section 20 21 22
basisphenoid bone
moderate moderate
homogeneousmoderate expression: see section 11 12 13 14 15 16
temporal bone petrous part
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 19
vault of skull
moderate moderate
homogeneousmoderate expression: see section 01
orbito-sphenoid
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 19 weak expression: see section 20 21 22
scapula
moderate moderate
homogeneousmoderate expression: see section 03 04
pelvic girdle skeleton
moderate moderate
homogeneousmoderate expression: see section 08 09 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36100
Entity Detected:C77370, expressed sequence C77370 ( MGI:2148050)
Sequence:sense strand is shown

>T36100
GTGGTTGCAACAAGGTTCTGTATGCCTCTTTGCAGGACTCACATCTCCCACCTGAAGACTTGTATCAATT
GTGTCACTTTAATAATGGAGAGATCTGCTTTCCGTTCCAGCAGGGCCCACTCAGTACAGATGATGATGGC
CGGCTCTTTAGCTTTGATTCGATGACTTCCCTTACTGTTAGTTCAAGCAATTATTGTTCCTTAAGCTTGA
AATCCTGTGAAAAGGATGGTGATGATGAAATCAATGATGACTTTCTGGCCCACTGCAGCCCCAAACTGGT
GATCCAACAGAGCATTGATGAAATAGCACCACTAAAGGAGTCCACTGACCTCCTTGACATCTCCAACTTC
ACTCCTGACAAGTTCCGACACTCTTCTCTCTTAGAAATGTCTCCCCCAGACACCCCCAGTCTTTCTCCTC
AGAGTACCAGATGTGAGAGTATCAAAACACTAGGAACAATGAAAGGATTCCAAGAAGGTGTCCCAGGATC
GTTGAGCACCGTGGAAAAAATCAAGTGGGACTGTAATACCCTTTCACAACAGGCCCAAGCAGATGATGGC
TTTACATTAAATAGCCATCAGTTTCAGTTCCATATGTTCAATGATGAGGACTCTGTTGGCCTGCTCCAAA
AAAGCCCTTGCCTGTCAACATTTGATGAGCCAGCTGGGCAAATTAATACCAACAGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 86711. Forward Primer - name:086711_F_cDNA_C77370, sequence:GTGGTTGCAACAAGGTTCTGTA; Reverse Primer - name:086711_N_SP6_cDNA_C77370, sequence:GCTGTTGGTATTAATTTGCCC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18195 same embryo
 EMAGE:18192 same embryo
 EMAGE:18194 same embryo
 EMAGE:18191 same embryo
 EMAGE:18193 same embryo
 EurExpress:euxassay_011971 same experiment
 MGI:4823561 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS