Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18197

Cadps2 Ca2+-dependent activator protein for secretion 2 ( MGI:2443963)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18197 EMAGE:18197 EMAGE:18197 EMAGE:18197 EMAGE:18197
"Pseudo-wholemount" of euxassay_011972. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011972_01 euxassay_011972_02 euxassay_011972_03 euxassay_011972_04
EMAGE:18197 EMAGE:18197 EMAGE:18197 EMAGE:18197 EMAGE:18197
euxassay_011972_05 euxassay_011972_06 euxassay_011972_07 euxassay_011972_08 euxassay_011972_09
EMAGE:18197 EMAGE:18197 EMAGE:18197 EMAGE:18197 EMAGE:18197
euxassay_011972_10 euxassay_011972_11 euxassay_011972_12 euxassay_011972_13 euxassay_011972_14
EMAGE:18197 EMAGE:18197 EMAGE:18197 EMAGE:18197 EMAGE:18197
euxassay_011972_15 euxassay_011972_16 euxassay_011972_17 euxassay_011972_18 euxassay_011972_19
EMAGE:18197 EMAGE:18197 EMAGE:18197 EMAGE:18197 EMAGE:18197
euxassay_011972_20 euxassay_011972_21 euxassay_011972_22 euxassay_011972_23 euxassay_011972_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18197Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18197_wholemount_strong.wlz
18197_wholemount_moderate.wlz
18197_wholemount_weak.wlz
18197_wholemount_possible.wlz
18197_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18197_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 01 02 03 22 23 24 weak expression: see section 04 05 06 21
radius
moderate moderate
regionalmoderate expression: see section 01
ulna
moderate moderate
regionalmoderate expression: see section 01
humerus
moderate moderate
regionalmoderate expression: see section 01 02 03 04 22 23 24
fibula
moderate moderate
regionalmoderate expression: see section 07 weak expression: see section 08 09 10 11
tibia
moderate moderate
regionalmoderate expression: see section 06 07 weak expression: see section 08 09 10 11
femur
moderate moderate
regionalmoderate expression: see section 06 07 weak expression: see section 08 09 10 11 12 13 14
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 11 12 13 17 18 19
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 19 20 21 22 23
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 03 17 18 19
otic capsule
weak weak
regionalweak expression: see section 09 16 17 18
naris
weak weak
regionalweak expression: see section 15 16 17 18 19 20
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 18 19 20 21 22 moderate expression: see section 11 12
nasal septum
weak weak
regionalweak expression: see section 16 17
viscerocranium
weak weak
regionalExpression in the turbinate bone.
meckel's cartilage
weak weak
regionalweak expression: see section 07 08 09 10 12 13 14 15 16 17
axial skeleton
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16 17
basioccipital bone
moderate moderate
regionalmoderate expression: see section 01 02 03 04 21 22 23 24 weak expression: see section 19 20
basisphenoid bone
weak weak
regionalweak expression: see section 11 12 13 14 15 16
temporal bone petrous part
moderate moderate
regionalmoderate expression: see section 01 02 03 04 21 22 23 24 weak expression: see section 05
vault of skull
moderate moderate
regionalmoderate expression: see section 01 02 03 24
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 02 03 04 weak expression: see section 05 06 07 08 09
clavicle
moderate moderate
regionalmoderate expression: see section 20
scapula
moderate moderate
regionalmoderate expression: see section 01 02 03 04 22 23 24
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 23 24 weak expression: see section 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36103
Entity Detected:Cadps2, Ca2+-dependent activator protein for secretion 2 ( MGI:2443963)
Sequence:sense strand is shown

>T36103
CCACTTCAGATACTGCTTTCCCTTCGGACGACCTGAGGGTGCCCTAAAAGCTACGCTCTCCTTACTTGAA
AGGGTTTTAATGAAAGACATTGCCACTCCTATCCCTGCGGAGGAGGTGAAGAAAGTGGTCAGAAAATGTC
TGGAGAAAGCTGCCTTGATCAATTACACTAGGCTCACAGAATATGCCAAAATAGAAGGGCCCGCAGAAAA
GGAAACAGAGACCATGAACCAGGCAACTCCTGCCAGGAAGCTGGAAGAGGTTCTTCATCTTGCAGAGCTC
TGCATAGAAGTCCTACAGCAAAATGAGGAGCATCATGCTGAGGGAAGAGAGGCATTTGCCTGGTGGCCTG
ACTTGTTGGCCGAGCATGCAGAGAAGTTTTGGGCTTTATTCACAGTAGACATGGATACTGCGCTGGAGGC
CCAACCTCAAGACTCCTGGGATAGCTTTCCCCTTTTCCAGCTGCTTAATAATTTCCTCAGAAATGACACA
CTTTTGTGTAATGGAAAATTCCACAAGCACTTGCAAGAAATCTTTGTGCCCTTGGTTGTCCGCTACGTTG
ACCTGATGGAGTCTGCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 94134. Forward Primer - name:094134_F_cDNA_Cadps2, sequence:CCACTTCAGATACTGCTTTCCC; Reverse Primer - name:094134_N_SP6_cDNA_Cadps2, sequence:GGCAGACTCCATCAGGTCAAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18198 same embryo
 EMAGE:18199 same embryo
 EurExpress:euxassay_011972 same experiment
 MGI:4823593 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS