Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18233

Zfp932 zinc finger protein 932 ( MGI:1916754)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18233 EMAGE:18233 EMAGE:18233 EMAGE:18233 EMAGE:18233
"Pseudo-wholemount" of euxassay_012004. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012004_01 euxassay_012004_02 euxassay_012004_03 euxassay_012004_04
EMAGE:18233 EMAGE:18233 EMAGE:18233 EMAGE:18233 EMAGE:18233
euxassay_012004_05 euxassay_012004_06 euxassay_012004_07 euxassay_012004_08 euxassay_012004_09
EMAGE:18233 EMAGE:18233 EMAGE:18233 EMAGE:18233 EMAGE:18233
euxassay_012004_10 euxassay_012004_11 euxassay_012004_12 euxassay_012004_13 euxassay_012004_14
EMAGE:18233 EMAGE:18233 EMAGE:18233 EMAGE:18233 EMAGE:18233
euxassay_012004_15 euxassay_012004_16 euxassay_012004_17 euxassay_012004_18 euxassay_012004_19

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18233Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18233_wholemount_strong.wlz
18233_wholemount_moderate.wlz
18233_wholemount_weak.wlz
18233_wholemount_possible.wlz
18233_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18233_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
weak weak
regionalweak expression: see section 01 02 03 04 05 14 15 16 17 18 19
radius
weak weak
regionalweak expression: see section 01 02
ulna
weak weak
regionalweak expression: see section 01
humerus
weak weak
regionalweak expression: see section 01 02 03 17 18 19
hip
weak weak
regionalweak expression: see section 09 14
fibula
weak weak
regionalweak expression: see section 01
tibia
weak weak
regionalweak expression: see section 01
femur
weak weak
regionalweak expression: see section 02 03 04 05 06 17 18 19
meckel's cartilage
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 11 13 15 16 17 18 19
axial skeleton
weak weak
regionalweak expression: see section 05 06 07 08 10 11 12 13
basioccipital bone
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13
basisphenoid bone
weak weak
regionalweak expression: see section 09 10 11 12 13
exoccipital bone
weak weak
regionalweak expression: see section 01 02 14 15
temporal bone petrous part
weak weak
regionalweak expression: see section 01 18 19
orbito-sphenoid
weak weak
regionalweak expression: see section 05 06 17 18
scapula
weak weak
regionalweak expression: see section 01 02 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30065
Entity Detected:Zfp932, zinc finger protein 932 ( MGI:1916754)
Sequence:sense strand is shown

>T30065
CCATTGTCATCCTCGAATGCATAAAAGAACGCATACTAAAGAGTAACCCTATGAATATAACCAATGTGGT
AAAGCCTTACAGTGATCTTGAAAGGTGTGGTGGACTAAATATACTTGGCCCATGACAAGTGGCAGTAGTA
GGGAGTGTGGCCTTTCTGGCATAGATGTGGTGTTTGAGAAAGTCTGTCACTATATGCTTGGACCTTGAGA
TCCACACAGGGCAGAAGAGTCTTCTGGCTTCTGATCAAGATGTAGAACTCTTGTCTCCTCCAGCACCATG
TCTGCTTGGACACTGCCAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3710576), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 35207. Forward Primer - name:035207_F_IRAV20-23_C19_2310001H12Rik, sequence:CCATTGTCATCCTCGAATGC; Reverse Primer - name:035207_R_SP6_IRAV20-23_C19_2310001H12Rik, sequence:AATGGCAGTGTCCAAGCAG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18230 same embryo
 EMAGE:18229 same embryo
 EMAGE:18232 same embryo
 EMAGE:18228 same embryo
 EMAGE:18231 same embryo
 EurExpress:euxassay_012004 same experiment
 MGI:4822657 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS