Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18244

Cd36 CD36 antigen ( MGI:107899)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18244 EMAGE:18244 EMAGE:18244 EMAGE:18244 EMAGE:18244
"Pseudo-wholemount" of euxassay_012019. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012019_01 euxassay_012019_02 euxassay_012019_03 euxassay_012019_04
EMAGE:18244 EMAGE:18244 EMAGE:18244 EMAGE:18244 EMAGE:18244
euxassay_012019_05 euxassay_012019_06 euxassay_012019_07 euxassay_012019_08 euxassay_012019_09
EMAGE:18244 EMAGE:18244 EMAGE:18244 EMAGE:18244 EMAGE:18244
euxassay_012019_10 euxassay_012019_11 euxassay_012019_12 euxassay_012019_13 euxassay_012019_14
EMAGE:18244 EMAGE:18244 EMAGE:18244 EMAGE:18244 EMAGE:18244
euxassay_012019_15 euxassay_012019_16 euxassay_012019_17 euxassay_012019_18 euxassay_012019_19
EMAGE:18244 EMAGE:18244 EMAGE:18244 EMAGE:18244 EMAGE:18244
euxassay_012019_20 euxassay_012019_21 euxassay_012019_22 euxassay_012019_23 euxassay_012019_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18244Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18244_wholemount_strong.wlz
18244_wholemount_moderate.wlz
18244_wholemount_weak.wlz
18244_wholemount_possible.wlz
18244_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18244_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 20 21 22 moderate expression: see section 01 02 03 11 19 weak expression: see section 14 15 16 17 18
radius
strong strong
regionalstrong expression: see section 01 02 03
ulna
strong strong
regionalstrong expression: see section 01
humerus
strong strong
regionalstrong expression: see section 01 02 03 20 21 22 23 24 moderate expression: see section 04 19
hip
strong strong
regionalstrong expression: see section 07
fibula
strong strong
regionalstrong expression: see section 01 02 03 24 moderate expression: see section 06
tibia
strong strong
regionalstrong expression: see section 01 02 03 04 24 moderate expression: see section 05 06
femur
strong strong
regionalstrong expression: see section 01 02 03 04 17 18 19 20 21 moderate expression: see section 05 06
meckel's cartilage
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 12 13 17 18 19 20 21 moderate expression: see section 16 weak expression: see section 14 15
axial skeleton
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 12 13 moderate expression: see section 11 weak expression: see section 14
basioccipital bone
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14
basisphenoid bone
strong strong
regionalstrong expression: see section 09 10 11 12 13 14
exoccipital bone
strong strong
regionalstrong expression: see section 01 02 03 15 16 21 22
temporal bone
strong strong
regionalstrong expression: see section 01 02 03 18 19 20 moderate expression: see section 17
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 18 19 20
viscerocranium
strong strong
regionalExpression in the turbinate bone.
scapula
strong strong
regionalstrong expression: see section 01 02 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2900
Entity Detected:Cd36, CD36 antigen ( MGI:107899)
Sequence:sense strand is shown

>T2900
GGCCTCGAGCCAGATTCGGCACGAGGTATTTTTTAATAAAATCTTGCACTTTTATTAAAAGTCCATCATT
TGCAACTGAGTGGACTTCAATTTCTGTAGACCCAATTATCCTGTTTGGTTCTGATTTACTGATTTGTTCC
ATGTTGGCAAATTTCAAGAATGTACATTCTGAGAAATTTTTGTTTTCCCTCACTGGAGGAAACTGCTATC
ATGACTGGGGTGGCCCCTTTGTTTATAGCAAATTTGGCTTGCAACTGTCAGCACATGGCATAAGTATAAC
ATCTTGAAAGACTTAAGAATGAAAAATGAACAATTCACATGTGAGCCACTGCTTATATATTAAGTCTCTC
CCTCTCTGGAGTTCTTGGCTACAGCAAGGCCAGATATCACATTGGTTTTGGTTTTGTTGTTTTTGTTTTG
TTTTTGTTTTTTACTCTCTGACACAGAGCTTATGAAATGGACTTTTTTTTTTTTTTTTAGCATACCTTAG
CTCTTTGTATTTTAAGTATGTCGTCATGTTCCATGCTGCATAGCTCTTTAAAAAACCTGAGTAGGTTTTT
CTCTTTCTGCTCAGCTG
Notes:The probe template was PCR amplified from IMAGE:1531159 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1531159 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18242 same embryo
 EMAGE:18243 same embryo
 EurExpress:euxassay_012019 same experiment
 MGI:4823728 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS