Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18272

Foxp1 forkhead box P1 ( MGI:1914004)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18272 EMAGE:18272 EMAGE:18272 EMAGE:18272 EMAGE:18272
"Pseudo-wholemount" of euxassay_012052. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012052_01 euxassay_012052_02 euxassay_012052_03 euxassay_012052_04
EMAGE:18272 EMAGE:18272 EMAGE:18272 EMAGE:18272 EMAGE:18272
euxassay_012052_05 euxassay_012052_06 euxassay_012052_07 euxassay_012052_08 euxassay_012052_09
EMAGE:18272 EMAGE:18272 EMAGE:18272 EMAGE:18272 EMAGE:18272
euxassay_012052_10 euxassay_012052_11 euxassay_012052_12 euxassay_012052_13 euxassay_012052_14
EMAGE:18272 EMAGE:18272 EMAGE:18272 EMAGE:18272 EMAGE:18272
euxassay_012052_15 euxassay_012052_16 euxassay_012052_17 euxassay_012052_18 euxassay_012052_19
EMAGE:18272 EMAGE:18272 EMAGE:18272 EMAGE:18272 EMAGE:18272
euxassay_012052_20 euxassay_012052_21 euxassay_012052_22 euxassay_012052_23 euxassay_012052_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18272Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18272_wholemount_strong.wlz
18272_wholemount_moderate.wlz
18272_wholemount_weak.wlz
18272_wholemount_possible.wlz
18272_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18272_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 01 02 20 21 weak expression: see section 03 04 05 06 07 08 15 16 17 19 22
forearm mesenchyme
strong strong
regionalstrong expression: see section 24
humerus
strong strong
regionalstrong expression: see section 01 02 20 21 22 23 24 moderate expression: see section 03 weak expression: see section 04
hand
moderate moderate
regionalmoderate expression: see section 01 02 03 23 24
hindlimb digit 1 metatarsal
strong strong
regionalstrong expression: see section 01 moderate expression: see section 02
hindlimb digit 2 metatarsal
strong strong
regionalstrong expression: see section 01 moderate expression: see section 02
hindlimb digit 3 metatarsal
strong strong
regionalstrong expression: see section 01 moderate expression: see section 02
hindlimb digit 4 metatarsal
strong strong
regionalstrong expression: see section 01 moderate expression: see section 02
hindlimb digit 5 metatarsal
strong strong
regionalstrong expression: see section 01
foot mesenchyme
strong strong
regionalstrong expression: see section 01
fibula
moderate moderate
regionalmoderate expression: see section 24
tibia
moderate moderate
regionalmoderate expression: see section 24
femur
moderate moderate
regionalmoderate expression: see section 19 20 21 22
telencephalon mantle layer
strong strong
regionalstrong expression: see section 07 08 09 19 20 21 22 moderate expression: see section 06
nasal septum
moderate moderate
regionalmoderate expression: see section 14 15
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 15 16 17 weak expression: see section 11 12
axial skeleton
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 15
basioccipital bone
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14
basisphenoid bone
weak weak
regionalweak expression: see section 10 11 13 14
exoccipital bone
weak weak
regionalweak expression: see section 03 04 16 17
temporal bone
weak weak
regionalweak expression: see section 01 03 04 19 20 21
orbito-sphenoid
weak weak
regionalweak expression: see section 04 08 19 20
viscerocranium
weak weak
regionalExpression in the turbinate bone.
scapula
strong strong
regionalstrong expression: see section 02 moderate expression: see section 03 19 20
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 09 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35445
Entity Detected:Foxp1, forkhead box P1 ( MGI:1914004)
Sequence:sense strand is shown

>T35445
ACCTTCCAAGTCCTCCCTAATCATGAACCCGCATGCCTCTACCAATGGACAGCTCTCGGTCCACACTCCC
AAAAGGGAAAGCTTGTCCCACGAGGAGCACCCCCACAGCCACCCTCTCTATGGACATGGCGTATGCAAGT
GGCCAGGCTGTGAGGCGGTTTGTGACGACTTCCCAGCCTTTCTAAAACATCTCAACAGTGAGCATGCGCT
GGACGATAGAAGCACAGCTCAATGTAGAGTACAAATGCAGGTTGTACAGCAGTTAGAGCTACAGCTTGCA
AAAGACAAAGAGCGCCTGCAAGCCATGATGACCCACCTGCATGTGAAGTCTACAGAACCCAAAGCTGCCC
CTCAGCCCCTGAATCTGGTATCAAGTGTCACCCTCTCCAAGTCTGCCTCAGAGGCTTCTCCACAGAGCTT
ACCTCATACTCCAACAACCCCCACCGCCCCCCTGACTCCTGTCACCCAAGGCCCCTCCGTCATCACCACC
ACCAGCATGCACACGGTGGGACCTATCCGCAGGCGGTACTCAGACAAATACAACGTGCCCATTTCTTCAG
CAGATATTGCGCAGAACCAAGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 66525. Forward Primer - name:066525_F_cDNA_Foxp1, sequence:ACCTTCCAAGTCCTCCCTAATC; Reverse Primer - name:066525_N_SP6_cDNA_Foxp1, sequence:TCTTGGTTCTGCGCAATATCT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18270 same embryo
 EMAGE:18271 same embryo
 EurExpress:euxassay_012052 same experiment
 MGI:4824914 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS