Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18282

Cyfip2 cytoplasmic FMR1 interacting protein 2 ( MGI:1924134)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18282 EMAGE:18282 EMAGE:18282 EMAGE:18282 EMAGE:18282
"Pseudo-wholemount" of euxassay_012077. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012077_01 euxassay_012077_02 euxassay_012077_03 euxassay_012077_04
EMAGE:18282 EMAGE:18282 EMAGE:18282 EMAGE:18282 EMAGE:18282
euxassay_012077_05 euxassay_012077_06 euxassay_012077_07 euxassay_012077_08 euxassay_012077_09
EMAGE:18282 EMAGE:18282 EMAGE:18282 EMAGE:18282 EMAGE:18282
euxassay_012077_10 euxassay_012077_11 euxassay_012077_12 euxassay_012077_13 euxassay_012077_14
EMAGE:18282 EMAGE:18282 EMAGE:18282 EMAGE:18282 EMAGE:18282
euxassay_012077_15 euxassay_012077_16 euxassay_012077_17 euxassay_012077_18 euxassay_012077_19
EMAGE:18282 EMAGE:18282 EMAGE:18282 EMAGE:18282 EMAGE:18282
euxassay_012077_20 euxassay_012077_21 euxassay_012077_22 euxassay_012077_23 euxassay_012077_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18282Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18282_wholemount_strong.wlz
18282_wholemount_moderate.wlz
18282_wholemount_weak.wlz
18282_wholemount_possible.wlz
18282_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18282_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 17 18 19 20 21 weak expression: see section 01 02 03 04 05 06 07 08 09 10 14 15 16 22
humerus
strong strong
regionalstrong expression: see section 21 22 23 24 moderate expression: see section 01 02 03 19 20
fibula
moderate moderate
regionalmoderate expression: see section 01 02 23 24
tibia
moderate moderate
regionalmoderate expression: see section 01 02 03 23 24
femur
moderate moderate
regionalmoderate expression: see section 01 02 03 17 18 19 20 21 weak expression: see section 04 16
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
facial vii ganglion
strong strong
regionalstrong expression: see section 17 18 19
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 04 05 moderate expression: see section 06 15
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 07 08 17 18 19 20 moderate expression: see section 06 16
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 15 16
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 16
spinal cord
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12
dorsal root ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 09 11 12 13 14
neural retina
moderate moderate
regionalmoderate expression: see section 02 03 04 23 24 weak expression: see section 01
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 18 19 20
not examined not examined
regionalnot examined expression: see section 16
vomeronasal organ
strong strong
regionalstrong expression: see section 13 moderate expression: see section 16
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 13 17 18 19 20 21 weak expression: see section 04 05 06 07 08 09 10 14 15 16
basioccipital bone
moderate moderate
regionalmoderate expression: see section 08 09 13 weak expression: see section 10 12
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 09 13 weak expression: see section 10 12
exoccipital bone
moderate moderate
regionalmoderate expression: see section 01 02 16 17 18 22 23
temporal bone
moderate moderate
regionalmoderate expression: see section 01 02 17 18 19 20 21 22
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 02 07 08 18 19 20 22 23
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
scapula
moderate moderate
regionalmoderate expression: see section 01 02 18 19 20
pelvic girdle skeleton
weak weak
regionalweak expression: see section 05 06 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30701
Entity Detected:Cyfip2, cytoplasmic FMR1 interacting protein 2 ( MGI:1924134)
Sequence:sense strand is shown

>T30701
GGACAGCCAGAAGTCGGATGAAGAGTACCGGGAGCTTTTTGACCTGGCCCTGCGAGGCCTGCAGCTTCTA
TCCAAGTGGAGTGCCCATGTCATGGAGGTGTACTCTTGGAAGCTGGTTCACCCCACAGACAAGTTCTGCA
ACAAGGACTGCCCGGGCACCGCGGAAGAGTACGAGAGAGCCACGCGCTACAATTATACCAGCGAGGAGAA
GTTTGCCTTTGTGGAGGTGATTGCCATGATCAAGGGTTTGCAGGTGCTCATGGGAAGGATGGAGAGTGTC
TTCAACCAGGCCATCCGCAACACTATCTACGCAGCCCTGCAGGATTTCGCCCAGGTGACGCTGCGGGAGC
CGTTGCGGCAAGCAGTTCGAAAGAAAAAGAATGTCCTTATCAGCGTTCTGCAAGCAATTCGAAAGACCAT
CTGTGACTGGGAGGGAGGCCGAGAGCCCCCCAATGACCCATGCTTAAGAGGGGAGAAGGACCCCAAAGGT
GGCTTTGACATCAAGGTGCCCCGCCGTGCTGTGGGTCCATCCAGCACACAGCTGTACATGGTGCGCACCA
TGCTTGAGTCACTCATCGCAGACAAGAGCGGCTCCAAGAAGACGCTCAGAAGCAGCCTGGATGGCCCTAT
CGTCCTTGCCATAGAGGACTTCCACAAGCAGTCCTTCTTTTTCACACACCTGCTTAACATCAGCGAGGCT
CTTCAGCAGTGCTGTGACCTCTCCCAGCTCTGGTTCCGAGAATTCTTCCTGGAGTTGACCATGGGCCGGC
GAATCCAGTTCCCGATTGAGATGTCCATGCCCTGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6831770), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 59601. Forward Primer - name:059601_F_IRAV118_g06_Cyfip2, sequence:GGACAGCCAGAAGTCGGA; Reverse Primer - name:059601_R_SP6_IRAV118_g06_Cyfip2, sequence:TCCAGGGCATGGACATCT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18280 same embryo
 EMAGE:18281 same embryo
 EMAGE:18284 same embryo
 EMAGE:18283 same embryo
 EurExpress:euxassay_012077 same experiment
 MGI:4824154 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS