Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18283

Stk36 serine/threonine kinase 36 (fused homolog, Drosophila) ( MGI:1920831)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18283 EMAGE:18283 EMAGE:18283 EMAGE:18283 EMAGE:18283
"Pseudo-wholemount" of euxassay_012083. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012083_01 euxassay_012083_02 euxassay_012083_03 euxassay_012083_04
EMAGE:18283 EMAGE:18283 EMAGE:18283 EMAGE:18283 EMAGE:18283
euxassay_012083_05 euxassay_012083_06 euxassay_012083_07 euxassay_012083_08 euxassay_012083_09
EMAGE:18283 EMAGE:18283 EMAGE:18283 EMAGE:18283 EMAGE:18283
euxassay_012083_10 euxassay_012083_11 euxassay_012083_12 euxassay_012083_13 euxassay_012083_14
EMAGE:18283 EMAGE:18283 EMAGE:18283 EMAGE:18283 EMAGE:18283
euxassay_012083_15 euxassay_012083_16 euxassay_012083_17 euxassay_012083_18 euxassay_012083_19
EMAGE:18283 EMAGE:18283 EMAGE:18283 EMAGE:18283 EMAGE:18283
euxassay_012083_20 euxassay_012083_21 euxassay_012083_22 euxassay_012083_23 euxassay_012083_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18283Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18283_wholemount_strong.wlz
18283_wholemount_moderate.wlz
18283_wholemount_weak.wlz
18283_wholemount_possible.wlz
18283_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18283_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 21 moderate expression: see section 04 05 06 14 15 17 22 weak expression: see section 01 02 03 07 08 09 10 13 16 18 19 20
humerus
strong strong
regionalstrong expression: see section 01 02 19 20 21 22 23 moderate expression: see section 24 weak expression: see section 03
fibula
strong strong
regionalstrong expression: see section 01 moderate expression: see section 22 23 24
tibia
strong strong
regionalstrong expression: see section 01 02 moderate expression: see section 03 22 23 24
femur
strong strong
regionalstrong expression: see section 01 02 17 moderate expression: see section 03 04 14 15 16 18 19 20
otic capsule
weak weak
regionalweak expression: see section 04 05 06 07
nasal septum
weak weak
regionalweak expression: see section 14 15
meckel's cartilage
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 15 16 17 18 19 20 moderate expression: see section 10 11 14 21
axial skeleton
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 moderate expression: see section 04 05
basioccipital bone
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 09 10 12 13
exoccipital bone
strong strong
regionalstrong expression: see section 01 02 15 16 17 moderate expression: see section 14 18 19
temporal bone
strong strong
regionalstrong expression: see section 01 02 17 20 21 moderate expression: see section 03 18 19
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 20 22 23 moderate expression: see section 03 06 07 08 19
viscerocranium
strong strong
regionalExpression in the turbinate bone.
clavicle
moderate moderate
regionalmoderate expression: see section 04 17 weak expression: see section 16
scapula
strong strong
regionalstrong expression: see section 01 02 18 19 moderate expression: see section 20
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 05 06 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30703
Entity Detected:Stk36, serine/threonine kinase 36 (fused homolog, Drosophila) ( MGI:1920831)
Sequence:sense strand is shown

>T30703
GCAGGATCTGCCCTTGAACAAGAAGACGGGCTCTGCAAGGTGACACCCAGCACAGCCCCCGTGCCTGGAC
TAAAGGCCACTCCTCAGGAGTCAAGCCTCTTGGCTGGTATACTGGCTTCAGAAATGAAGAACAACTGGGA
AGACTGGGGGGCTGGAGAAGCACCCCGTACCTCTCGGGAAAACCACATCAACCTGGAGTGTGAACAAGGC
TTCCCAGAGCCGAGGCCAGAGGCGATGGGCCGGCAGAGCACTGATGTAGTGGATCCTGAAAATGAGGAGC
CAGACAGTGATGATGAGTGGCAACGCCTACTAGAGACCAGCGAGCCTGGGCCTGTGCAGCTGAAGTCCCC
CCTCACCCTGTTGTGTAACCCTGACTTCTGCCAGCGCATCCAGAGTCAGCTGCGCGGGACTGGCGAGCAG
ATCCTGAAAGGCGTTCTGGATGGTGTGTCCCACCTCCTTCCTGTACTCCGCATCCTGAGTAGTCTCCTAT
CCAGCTGCAATGACTCTGTGCTCTTGTATTCCTTCTGCCAGGAGGCAGGACTGCCTGAGCTGCCTCTCAG
CCTTCTTAGGTACAGCCAGGAGAGTAGCAGCATCCAGCAGCAACCTTGGTATGGGGCGCTCTTACGGGAC
CTGGTGGCTGTGGTTCAGGCCTACTTTTCGTGCACCTTCAATCTGGAGAGGAGCCAGACAGGTGACAGCC
TACAGGTGTTTCAGGAGGCCGCCAGCCTCTTTTTGGACCTGTTGGGGAAGCTGCTGGCCCAATCAGATGA
TTCCGAGCAGACATTTCGAAGGGATAGCCTTATGTGCTTTGCTGTCTTGTGTGAAGCTGTGGACGGAAAC
AGCTGGGCCGTCTCCAAAGCCTTCTACTCCAGCCTGTTGACCACACAGCGCGCTGTGTTGGATGGCCTCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6826542), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 59815. Forward Primer - name:059815_F_IRAV118_h08_Stk36, sequence:GCAGGATCTGCCCTTGAA; Reverse Primer - name:059815_R_SP6_IRAV118_h08_Stk36, sequence:AGGAGGCCATCCAACACA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18280 same embryo
 EMAGE:18281 same embryo
 EMAGE:18282 same embryo
 EMAGE:18284 same embryo
 EurExpress:euxassay_012083 same experiment
 MGI:4828504 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS