Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18284

Pcdhga12 protocadherin gamma subfamily A, 12 ( MGI:1935229)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18284 EMAGE:18284 EMAGE:18284 EMAGE:18284 EMAGE:18284
"Pseudo-wholemount" of euxassay_012080. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012080_01 euxassay_012080_02 euxassay_012080_03 euxassay_012080_04
EMAGE:18284 EMAGE:18284 EMAGE:18284 EMAGE:18284 EMAGE:18284
euxassay_012080_05 euxassay_012080_06 euxassay_012080_07 euxassay_012080_08 euxassay_012080_09
EMAGE:18284 EMAGE:18284 EMAGE:18284 EMAGE:18284 EMAGE:18284
euxassay_012080_10 euxassay_012080_11 euxassay_012080_12 euxassay_012080_13 euxassay_012080_14
EMAGE:18284 EMAGE:18284 EMAGE:18284 EMAGE:18284 EMAGE:18284
euxassay_012080_15 euxassay_012080_16 euxassay_012080_17 euxassay_012080_18 euxassay_012080_19
EMAGE:18284 EMAGE:18284 EMAGE:18284 EMAGE:18284 EMAGE:18284
euxassay_012080_20 euxassay_012080_21 euxassay_012080_22 euxassay_012080_23 euxassay_012080_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18284Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18284_wholemount_strong.wlz
18284_wholemount_moderate.wlz
18284_wholemount_weak.wlz
18284_wholemount_possible.wlz
18284_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18284_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 04 05 06 07 moderate expression: see section 01 02 03 weak expression: see section 13 14 15 16 17 19 20 21 22
humerus
strong strong
regionalstrong expression: see section 01 02 23 moderate expression: see section 03 19 20 21 24 weak expression: see section 22
fibula
strong strong
regionalstrong expression: see section 01 moderate expression: see section 23 24
tibia
strong strong
regionalstrong expression: see section 01 02 moderate expression: see section 03 23 24
femur
strong strong
regionalstrong expression: see section 01 02 moderate expression: see section 03 15 16 weak expression: see section 04 17 18 19 20
otic capsule
moderate moderate
regionalmoderate expression: see section 06 07 08 14 15 weak expression: see section 04 05
nasal septum
moderate moderate
regionalmoderate expression: see section 14 15
meckel's cartilage
strong strong
regionalstrong expression: see section 02 03 04 05 06 08 09 19 moderate expression: see section 07 10 11 12 14 15 16 17 18 20 21
axial skeleton
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 moderate expression: see section 12 weak expression: see section 13
basioccipital bone
strong strong
regionalstrong expression: see section 09 10 moderate expression: see section 07 08 11 12 13 14
basisphenoid bone
strong strong
regionalstrong expression: see section 09 10 moderate expression: see section 12 13
exoccipital bone
strong strong
regionalstrong expression: see section 01 02 moderate expression: see section 03 15 16 17
temporal bone
strong strong
regionalstrong expression: see section 01 02 moderate expression: see section 03 04 16 17 18 19 20 21
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 moderate expression: see section 06 07 08 12 18 19 20
viscerocranium
strong strong
regionalExpression in the turbinate bone.
clavicle
moderate moderate
regionalmoderate expression: see section 04 weak expression: see section 05 15
scapula
strong strong
regionalstrong expression: see section 01 02 weak expression: see section 19
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 05 06 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30702
Entity Detected:Pcdhga12, protocadherin gamma subfamily A, 12 ( MGI:1935229)
Sequence:sense strand is shown

>T30702
ATATTCTGCACGGGCCAAGGTCCTGGTCACAGTTCTGGACGTGAACGACAATGCCCCTGAAGTAGCCATC
ACGTCCCTCACCAACTCTGTCCCAGAAAACTCTCCCCAAGGGACATTAATAGCACTTTTAAACGTAAATG
ATCAAGATTCTGGGGAAAATGGACAGGTAATCTGTTCCATCCAAGAGAATCTGCCCTTTAAGTTAGAAAA
GTCTTACGGAAACTATTATAGATTAGTCACAGATGCAGTCCTGGACCGAGAAGAGGTTCCTAGTTACAAC
ATCACAATGACCGCCACTGACAGGGGAAGTCCGCCCCTGACAACAGAAACTCACCTCGCACTGGACATAG
CAGACACGAACGATAACTCGCCCGTTTTCCTTCAGGCCTCATACTGGGCCTACATCCCAGAGAATAACCC
TAGAGGGGCCTCTATCGCATCCGTGACCGCCCACGACCCCGACAGTGACAAAAATGCCCAAGTCACTTAC
TCCCTAGCTGAGGACACCCACCAGGGCGTGCCCCTTTCCTCTTACGTTTCCATCAACTCGGACACTGGTG
TCCTGTACGCACTGCATTCCTTTGACTACGAGCAGTTCCCAGACCTACAACTGCAAGTGATAGCGCGTGA
CAGCGGGGACCCGCCACTCAGCAGCAACGTGTCACTGAGCTTGTTCGTGCTGGATCAGAATGACAACGTC
CCCGAAATCTTGTACCCCACTCTCCCTACCGACGGTTCTACTGGAGTGGAGCTAGCACCCCGCTCAGCAG
AGCCTGGCTATCTGGTGACAAAGGTGGTGGCAGTGGACAGAGACTCAGGACAGAACGCCTGGCTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6831906), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 59699. Forward Primer - name:059699_F_IRAV118_g09_Pcdhga12, sequence:ATATTCTGCACGGGCCAA; Reverse Primer - name:059699_R_SP6_IRAV118_g09_Pcdhga12, sequence:ACAGCCAGGCGTTCTGTC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18280 same embryo
 EMAGE:18281 same embryo
 EMAGE:18282 same embryo
 EMAGE:18283 same embryo
 EurExpress:euxassay_012080 same experiment
 MGI:4827089 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS