Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18288

Crygd crystallin, gamma D ( MGI:88524)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18288 EMAGE:18288 EMAGE:18288 EMAGE:18288 EMAGE:18288
"Pseudo-wholemount" of euxassay_012076. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012076_01 euxassay_012076_02 euxassay_012076_03 euxassay_012076_04
EMAGE:18288 EMAGE:18288 EMAGE:18288 EMAGE:18288 EMAGE:18288
euxassay_012076_05 euxassay_012076_06 euxassay_012076_07 euxassay_012076_08 euxassay_012076_09
EMAGE:18288 EMAGE:18288 EMAGE:18288 EMAGE:18288 EMAGE:18288
euxassay_012076_10 euxassay_012076_11 euxassay_012076_12 euxassay_012076_13 euxassay_012076_14
EMAGE:18288 EMAGE:18288 EMAGE:18288 EMAGE:18288 EMAGE:18288
euxassay_012076_15 euxassay_012076_16 euxassay_012076_17 euxassay_012076_18 euxassay_012076_19
EMAGE:18288 EMAGE:18288 EMAGE:18288
euxassay_012076_20 euxassay_012076_21 euxassay_012076_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18288Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18288_wholemount_strong.wlz
18288_wholemount_moderate.wlz
18288_wholemount_weak.wlz
18288_wholemount_possible.wlz
18288_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18288_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 01 02 08 10 16 17 18 19 moderate expression: see section 05 06 07 09 11 12 20 21 22 weak expression: see section 03 04
radius
strong strong
regionalstrong expression: see section 01
humerus
strong strong
regionalstrong expression: see section 01 05 moderate expression: see section 02 03 04 06
hindlimb digit 3 metatarsal
moderate moderate
regionalmoderate expression: see section 02
hindlimb digit 4 metatarsal
moderate moderate
regionalmoderate expression: see section 02
tarsus
strong strong
regionalstrong expression: see section 02
tibia
strong strong
regionalstrong expression: see section 01
femur
strong strong
regionalstrong expression: see section 01 02 05 06 17 18 19 20 21 22 moderate expression: see section 03 04
otic capsule
moderate moderate
regionalmoderate expression: see section 09 10 17 18 weak expression: see section 19 20
lens
strong strong
regionalstrong expression: see section 01 02
nasal septum
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14
meckel's cartilage
strong strong
regionalstrong expression: see section 05 06 09 13 14 17 18 19 moderate expression: see section 04 07 08 10 11 12 15 16 21 22 weak expression: see section 20
axial skeleton
strong strong
regionalstrong expression: see section 08 10 11 12 13 14 15 16 17 18 19 moderate expression: see section 09 20
basioccipital bone
strong strong
regionalstrong expression: see section 10 11 12 13 14 17 18 19 moderate expression: see section 15 16
basisphenoid bone
strong strong
regionalstrong expression: see section 11 12 13 14 17 moderate expression: see section 15 16
exoccipital bone
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 moderate expression: see section 08 09 20 21 22
temporal bone
strong strong
regionalstrong expression: see section 03 04 05 06 07 moderate expression: see section 08 21 22
orbito-sphenoid
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 18 19 moderate expression: see section 08 15 20 21 22
viscerocranium
strong strong
regionalExpression in the turbinate bone.
clavicle
moderate moderate
regionalmoderate expression: see section 21 weak expression: see section 07
scapula
strong strong
regionalstrong expression: see section 05 moderate expression: see section 03 04
pelvic girdle skeleton
strong strong
regionalstrong expression: see section 07 08 15 moderate expression: see section 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30704
Entity Detected:Crygd, crystallin, gamma D ( MGI:88524)
Sequence:sense strand is shown

>T30704
CAGCCATGGGGAAGATCACCTTCTATGAGGACCGCGGCTTCCAGGGCCGCCACTATGAGTGCAGCACCGA
CCACTCCAACCTGCAGCCCTACTTCAGCCGCTGCAACTCTGTGCGCGTGGACAGTGGCTGCTGGATGCTC
TATGAGCAGCCCAACTTCACGGGCTGCCAGTACTTCCTGCGTCGCGGGGACTACCCTGACTACCAGCAGT
GGATGGGTTTCAGTGACTCTGTCCGCTCCTGCCGCCTCATCCCCCACGCCGGCTCTCACAGGATCAGACT
GTACGAGAGGGAAGAGTACAGAGGCCAGATGATAGAGTTCACGGAGGACTGCCCCTCTCTCCAGGACCGA
TTCCACTTCAATGAGATCTACTCCCTCAATGTGCTAGAGGGCTGCTGGGTCCTCTACGACATGACCAACT
ACCGGGGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6824399), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 59745. Forward Primer - name:059745_F_IRAV118_h10_Cryge, sequence:CAGCCATGGGGAAGATCA; Reverse Primer - name:059745_R_SP6_IRAV118_h10_Cryge, sequence:TTCCCCGGTAGTTGGTCA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18287 same embryo
 EMAGE:18290 same embryo
 EMAGE:18289 same embryo
 EMAGE:18286 same embryo
 EMAGE:18285 same embryo
 EurExpress:euxassay_012076 same experiment
 MGI:4824071 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS