Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18291

Gucy1a3 guanylate cyclase 1, soluble, alpha 3 ( MGI:1926562)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18291 EMAGE:18291 EMAGE:18291 EMAGE:18291 EMAGE:18291
"Pseudo-wholemount" of euxassay_012078. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012078_01 euxassay_012078_02 euxassay_012078_03 euxassay_012078_04
EMAGE:18291 EMAGE:18291 EMAGE:18291 EMAGE:18291 EMAGE:18291
euxassay_012078_05 euxassay_012078_06 euxassay_012078_07 euxassay_012078_08 euxassay_012078_09
EMAGE:18291 EMAGE:18291 EMAGE:18291 EMAGE:18291 EMAGE:18291
euxassay_012078_10 euxassay_012078_11 euxassay_012078_12 euxassay_012078_13 euxassay_012078_14
EMAGE:18291 EMAGE:18291 EMAGE:18291 EMAGE:18291 EMAGE:18291
euxassay_012078_15 euxassay_012078_16 euxassay_012078_17 euxassay_012078_18 euxassay_012078_19
EMAGE:18291 EMAGE:18291 EMAGE:18291 EMAGE:18291 EMAGE:18291
euxassay_012078_20 euxassay_012078_21 euxassay_012078_22 euxassay_012078_23 euxassay_012078_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18291Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18291_wholemount_strong.wlz
18291_wholemount_moderate.wlz
18291_wholemount_weak.wlz
18291_wholemount_possible.wlz
18291_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18291_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 17 18 23 24 moderate expression: see section 01 02 05 06 07 08 21 22 weak expression: see section 03 04 15 16 19 20
radius
strong strong
regionalstrong expression: see section 01 02 moderate expression: see section 03
ulna
strong strong
regionalstrong expression: see section 01
humerus
strong strong
regionalstrong expression: see section 01 02 04 21 22 23 moderate expression: see section 03 05 24
fibula
strong strong
regionalstrong expression: see section 01 02
tibia
strong strong
regionalstrong expression: see section 01 02 24 moderate expression: see section 03 04 23
femur
strong strong
regionalstrong expression: see section 02 05 06 07 21 24 moderate expression: see section 01 03 04 08 19 20 22 23
cerebral cortex marginal layer
moderate moderate
regionalmoderate expression: see section 13 14 18 weak expression: see section 07 08 09 10 11 12 15 16
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 18 19 20 weak expression: see section 09 16 21 22
otic capsule
moderate moderate
regionalmoderate expression: see section 17 weak expression: see section 07 08 09 10 16
esophagus
weak weak
regionalweak expression: see section 11 12
stomach
moderate moderate
regionalmoderate expression: see section 01 02 03 04 weak expression: see section 05 06 07 08 09
hindgut
weak weak
regionalweak expression: see section 12 13 14 15
midgut
weak weak
regionalweak expression: see section 12 13 14 15 16
meckel's cartilage
strong strong
regionalstrong expression: see section 06 07 08 09 13 17 18 19 21 22 moderate expression: see section 03 04 05 10 11 12 14 16
metanephros
moderate moderate
regionalmoderate expression: see section 07 08 09 17 18 19 weak expression: see section 10 16 20
testis
moderate moderate
regionalmoderate expression: see section 06 07 08 19 20 21 weak expression: see section 05 18
urethra of male
moderate moderate
regionalmoderate expression: see section 13 14
lung
moderate moderate
regionalmoderate expression: see section 23 24 weak expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
axial skeleton
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 moderate expression: see section 07
basioccipital bone
strong strong
regionalstrong expression: see section 09 10 11 13 14 15 16 17 moderate expression: see section 07 08 12
basisphenoid bone
strong strong
regionalstrong expression: see section 10 11 13 14 15 moderate expression: see section 12
exoccipital bone
strong strong
regionalstrong expression: see section 02 18 19 moderate expression: see section 01 03 04 05 06 20 21
temporal bone
strong strong
regionalstrong expression: see section 02 22 23 moderate expression: see section 01 03 04 05 06 19 20 21 24
orbito-sphenoid
strong strong
regionalstrong expression: see section 02 23 moderate expression: see section 01 03 06 07 08 19 20 21 24
viscerocranium
strong strong
regionalExpression in the turbinate bone.
clavicle
moderate moderate
regionalmoderate expression: see section 06 08 17 18 19 20
scapula
strong strong
regionalstrong expression: see section 04 21 22 moderate expression: see section 02 03 23
pelvic girdle skeleton
strong strong
regionalstrong expression: see section 09 10 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30690
Entity Detected:Gucy1a3, guanylate cyclase 1, soluble, alpha 3 ( MGI:1926562)
Sequence:sense strand is shown

>T30690
CCGGTATTGCCTGTTTGGAAACAATGTCACTCTGGCTAACAAATTTGAATCCTGCAGTGTGCCTCGGAAA
ATCAATGTCAGCCCCACCACATACAGGTTACTCAAAGACTGTCCTGGCTTTGTGTTCACCCCGAGATCAA
GGGAGGAGCTTCCACCAAACTTCCCTAGTGACATTCCTGGGATCTGTCACTTTCTGGATGCTTATCACCA
TCAAGGACCTAATTCCAAACCATGGTTCCAGGATAAAGATGTGGAAGATGGAAACGCCAACTTCTTAGGC
AAAGCGTCAGGGATAGATTAGTGAGCCACATGCTCTTATGTTTGATGCCTTTGAAGGTGTGCAGAACCTC
TGTGTTGACCTTAGGATTACAGAAGATAAAAAAAATCAGTGTTAAAATTACAGAGGCTAAACACAGGTTT
CCTCTGTCTCCCATTTAAGATGGAAAAGAAAAGTGTTCACTTCAGCGCTTCAACCTTCTTCTATTTAAGA
AACAGACCTCAAAAGTGACCTGTGACTTTTGGGGGCATAGTTGTGTTCTAGAACAGTCACTACCTGCACT
CAAAATCCAGCACATTGTACATATTCCAGGCAACTGTAGTCAAGTTTAAGTGTTGAAGTAATGGGTTCAC
CTATGGCCTGTGGCCAGCACAAGCTGTGGTTATTAAAGTGTATGTGTGTGTGATAGTGTCGCCTGTAAAA
TCTCTGAATAGAAACAACAGTGTTTAGTTCTGCAAGAACTCCCAGCCTCTCGACTCTACATTCAATTAGA
TTTCCTTATTTAATCGTGTCATATGTAGCACAATAGACCAGCATCACCTTTCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6825960), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 59660. Forward Primer - name:059660_F_IRAV118_c08_Gucy1a3, sequence:CCGGTATTGCCTGTTTGG; Reverse Primer - name:059660_R_SP6_IRAV118_c08_Gucy1a3, sequence:TGGAAAGGTGATGCTGGTC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18292 same embryo
 EurExpress:euxassay_012078 same experiment
 MGI:4825284 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS