Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18292

Unc5a unc-5 homolog A (C. elegans) ( MGI:894682)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18292 EMAGE:18292 EMAGE:18292 EMAGE:18292 EMAGE:18292
"Pseudo-wholemount" of euxassay_012094. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012094_01 euxassay_012094_02 euxassay_012094_03 euxassay_012094_04
EMAGE:18292 EMAGE:18292 EMAGE:18292 EMAGE:18292 EMAGE:18292
euxassay_012094_05 euxassay_012094_06 euxassay_012094_07 euxassay_012094_08 euxassay_012094_09
EMAGE:18292 EMAGE:18292 EMAGE:18292 EMAGE:18292 EMAGE:18292
euxassay_012094_10 euxassay_012094_11 euxassay_012094_12 euxassay_012094_13 euxassay_012094_14
EMAGE:18292 EMAGE:18292 EMAGE:18292 EMAGE:18292 EMAGE:18292
euxassay_012094_15 euxassay_012094_16 euxassay_012094_17 euxassay_012094_18 euxassay_012094_19
EMAGE:18292 EMAGE:18292
euxassay_012094_20 euxassay_012094_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18292Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18292_wholemount_strong.wlz
18292_wholemount_moderate.wlz
18292_wholemount_weak.wlz
18292_wholemount_possible.wlz
18292_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18292_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 weak expression: see section 09 10 11 12 14 15 16 17 18 19 20 21
radius
strong strong
regionalstrong expression: see section 01 02
humerus
strong strong
regionalstrong expression: see section 01 02 03 04 05 moderate expression: see section 18 19 20 21
hindlimb digit 1 metatarsal
strong strong
regionalstrong expression: see section 05
hindlimb digit 2 metatarsal
strong strong
regionalstrong expression: see section 05 06
hindlimb digit 3 metatarsal
strong strong
regionalstrong expression: see section 05 06 moderate expression: see section 18
hindlimb digit 4 metatarsal
strong strong
regionalstrong expression: see section 06 moderate expression: see section 18 weak expression: see section 07
hindlimb digit 5 metatarsal
strong strong
regionalstrong expression: see section 06 moderate expression: see section 18 weak expression: see section 07
tarsus
strong strong
regionalstrong expression: see section 04 05 weak expression: see section 19
fibula
strong strong
regionalstrong expression: see section 01 02
tibia
strong strong
regionalstrong expression: see section 01 02 03 weak expression: see section 20 21
femur
strong strong
regionalstrong expression: see section 01 02 03 04 06 07 08 moderate expression: see section 18 weak expression: see section 15 16 17 19 20 21
diencephalon lateral wall mantle layer
weak weak
regionalweak expression: see section 08 10 11 12 14
not examined not examined
regionalnot examined expression: see section 12 14 15 16 17
cerebral cortex marginal layer
weak weak
regionalweak expression: see section 04 09 10 11 12 14 15 16 17
telencephalon mantle layer
weak weak
regionalweak expression: see section 12 14 15 16 17 18 19 20 21
olfactory cortex marginal layer
weak weak
regionalweak expression: see section 11 12 14
ventral grey horn
weak weak
regionalweak expression: see section 09 10 11 12
otic capsule
strong strong
regionalstrong expression: see section 06 07 08 moderate expression: see section 09 14
meckel's cartilage
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 moderate expression: see section 14 15 18 19 weak expression: see section 09 10 11 12 13 16 17
axial skeleton
strong strong
regionalstrong expression: see section 07 08 weak expression: see section 09 10 11 12 13 14
basioccipital bone
strong strong
regionalstrong expression: see section 07 weak expression: see section 09 10 11 12 13
basisphenoid bone
weak weak
regionalweak expression: see section 10 11 12 13 20
exoccipital bone
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 moderate expression: see section 17 weak expression: see section 15 16 20 21
temporal bone
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 moderate expression: see section 17 18 weak expression: see section 16 19 20
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 moderate expression: see section 17 18 weak expression: see section 16 20 21
viscerocranium
strong strong
regionalExpression in the turbinate bone.
clavicle
strong strong
regionalstrong expression: see section 06 07 08 weak expression: see section 14 17
scapula
strong strong
regionalstrong expression: see section 02 03 04 weak expression: see section 18 19 20
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 09 weak expression: see section 10 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30677
Entity Detected:Unc5a, unc-5 homolog A (C. elegans) ( MGI:894682)
Sequence:sense strand is shown

>T30677
TGAGGTTGCCCCTAGCTGGCTGTCAGACCCTGCTGAGTCCTATCGTTAGCTGTGGGCCCCCAGGAGTCCT
GCTCACCCGGCCAGTCATCCTTGCCATGGACCACTGCGGGGAGCCCAGTCCCGACAGCTGGAGCCTGCGC
CTCAAAAAGCAGTCCTGTGAGGGCAGCTGGGAGGACGTGCTGCACCTTGGTGAGGAGTCGCCCTCTCATC
TCTACTACTGCCAGCTGGAGGCCGGGGCCTGCTATGTCTTTACCGAGCAGCTAGGCCGCTTTGCCCTGGT
GGGAGAGGCCCTCAGCGTGGCTGCCACCAAGCGCCTCAGGCTCCTTCTGTTTGCCCCTGTGGCCTGTACG
TCCCTCGAGTACAACATCCGAGTGTACTGCCTGCACGACACCCACGATGCTCTCAAGGAGGTGGTGCAGC
TGGAGAAGCAGCTGGGTGGACAGCTGATCCAGGAGCCCCGTGTCCTGCACTTCAAAGACAGTTACCACAA
CCTACGTCTGTCCATCCACGACGTGCCCAGCTCCCTGTGGAAGAGCAAGCTCCTTGTCAGCTACCAGGAG
ATCCCTTTTTACCACATCTGGAATGGCACTCAGCAGTATCTGCACTGCACCTTCACCCTGGAGCGCGTCA
ATGCCAGCACCAGCGACCTGGCCTGCAAGGTGTGGGTGTGGCAGGTGGAGGGAGATGGACAGAGCTTCAA
CATCAACTTTAACATCACTAAGGACACGAGGTTTGCTGAAATGCTGGCTCTGGAGAGTGAAGGGGGGGTC
CCAGCCCTGGTGGGCCCCAGTGCCTTCAAGATCCCCTTCCTCATTCGGCAAAAGATCATTACCAGCCTGG
ACCCACCCTGCAGCCGGGGCGCCGACTGGCGAACTCTAGCCCA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6813463), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 59544. Forward Primer - name:059544_F_IRAV117_g01_Unc5a, sequence:TGAGGTTGCCCCTAGCTG; Reverse Primer - name:059544_R_SP6_IRAV117_g01_Unc5a, sequence:CTGGGCTAGAGTTCGCCA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18291 same embryo
 EurExpress:euxassay_012094 same experiment
 MGI:4829099 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS