Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18311

Tusc3 tumor suppressor candidate 3 ( MGI:1933134)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18311 EMAGE:18311 EMAGE:18311 EMAGE:18311 EMAGE:18311
"Pseudo-wholemount" of euxassay_012104. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012104_01 euxassay_012104_02 euxassay_012104_03 euxassay_012104_04
EMAGE:18311 EMAGE:18311 EMAGE:18311 EMAGE:18311 EMAGE:18311
euxassay_012104_05 euxassay_012104_06 euxassay_012104_07 euxassay_012104_08 euxassay_012104_09
EMAGE:18311 EMAGE:18311 EMAGE:18311 EMAGE:18311 EMAGE:18311
euxassay_012104_10 euxassay_012104_11 euxassay_012104_12 euxassay_012104_13 euxassay_012104_14
EMAGE:18311 EMAGE:18311 EMAGE:18311 EMAGE:18311 EMAGE:18311
euxassay_012104_15 euxassay_012104_16 euxassay_012104_17 euxassay_012104_18 euxassay_012104_19
EMAGE:18311 EMAGE:18311 EMAGE:18311 EMAGE:18311 EMAGE:18311
euxassay_012104_20 euxassay_012104_21 euxassay_012104_22 euxassay_012104_23 euxassay_012104_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18311Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18311_wholemount_strong.wlz
18311_wholemount_moderate.wlz
18311_wholemount_weak.wlz
18311_wholemount_possible.wlz
18311_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18311_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 20 21
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 19 20
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 18 19 20 21 22 23
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07 08 18 19
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 20
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 18
spinal cord
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16
peripheral nervous system
moderate moderate
regionalmoderate expression: see section 09
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 16 17 18
neural retina
moderate moderate
regionalmoderate expression: see section 02 03 04 05
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30732
Entity Detected:Tusc3, tumor suppressor candidate 3 ( MGI:1933134)
Sequence:sense strand is shown

>T30732
CACTGCTCTGCAGCCTCAGCGGCAGTGTTCTGTGTGCAGCTCAACATGAACTCCGCTCCCACATTCATGC
ATTTTCCTTCAAAAGGCAGACCCAAGAGAGCTGATACTTTTGACCTTCAACGAATTGGATTTGCAGCTGA
GCAGCTAGCAAAATGGATTGCCGACAGGACGGATGTTCATATTCGAGTTTTCCGGCCACCCAACTACTCA
GGCACCATTGCTTTGGCCCTGTTAGTGTCACTGGTTGGTGGCTTGCTTTATCTAAGGAGGAACAACTTGG
AGTTTATCTATAACAAGACTGGTTGGGCCATGGTATCTCTGAGCTACATTCATGGAAGCAGCCAGGCTCA
GTTTGTGGCAGAGTCACACATCATTCTAGTACTGAATGCTGCTATCACCATGGGGATGGTTCTTCTAAAT
GAAGCAGCAACTTCCAAAGGGGATGTCGGGAAAAGACGCATCATTTGCCTCGTGGGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3154952), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 61584. Forward Primer - name:061584_F_IRAV01-03_A14_Tusc3, sequence:CACTGCTCTGCAGCCTCA; Reverse Primer - name:061584_R_SP6_IRAV01-03_A14_Tusc3, sequence:ATCCCACGAGGCAAATGA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18307 same embryo
 EMAGE:18309 same embryo
 EMAGE:18308 same embryo
 EMAGE:18310 same embryo
 EurExpress:euxassay_012104 same experiment
 MGI:4829024 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS