Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18312

H2-T22 histocompatibility 2, T region locus 22 ( MGI:95956)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18312 EMAGE:18312 EMAGE:18312 EMAGE:18312 EMAGE:18312
"Pseudo-wholemount" of euxassay_012111. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012111_01 euxassay_012111_02 euxassay_012111_03 euxassay_012111_04
EMAGE:18312 EMAGE:18312 EMAGE:18312 EMAGE:18312 EMAGE:18312
euxassay_012111_05 euxassay_012111_06 euxassay_012111_07 euxassay_012111_08 euxassay_012111_09
EMAGE:18312 EMAGE:18312 EMAGE:18312 EMAGE:18312 EMAGE:18312
euxassay_012111_10 euxassay_012111_11 euxassay_012111_12 euxassay_012111_13 euxassay_012111_14
EMAGE:18312 EMAGE:18312 EMAGE:18312 EMAGE:18312 EMAGE:18312
euxassay_012111_15 euxassay_012111_16 euxassay_012111_17 euxassay_012111_18 euxassay_012111_19
EMAGE:18312 EMAGE:18312 EMAGE:18312 EMAGE:18312 EMAGE:18312
euxassay_012111_20 euxassay_012111_21 euxassay_012111_22 euxassay_012111_23 euxassay_012111_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18312Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18312_wholemount_strong.wlz
18312_wholemount_moderate.wlz
18312_wholemount_weak.wlz
18312_wholemount_possible.wlz
18312_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18312_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 01 02 05 06 07 09 10 11 14 15 16 17 18 19 20 21 22 23 24 moderate expression: see section 03 04 08 12
humerus
strong strong
regionalstrong expression: see section 02 21 22 23 24
forelimb digit 2 phalanx
strong strong
regionalstrong expression: see section 01 02
forelimb digit 3 phalanx
strong strong
regionalstrong expression: see section 01 02
hindlimb digit 1 metatarsal
strong strong
regionalstrong expression: see section 08
hindlimb digit 1 phalanx
strong strong
regionalstrong expression: see section 08
hindlimb digit 2 metatarsal
strong strong
regionalstrong expression: see section 07 08
hindlimb digit 2 phalanx
strong strong
regionalstrong expression: see section 07 08 09
hindlimb digit 3 metatarsal
strong strong
regionalstrong expression: see section 07 08
hindlimb digit 3 phalanx
strong strong
regionalstrong expression: see section 07 08 09
hindlimb digit 4 metatarsal
strong strong
regionalstrong expression: see section 08
hindlimb digit 4 phalanx
strong strong
regionalstrong expression: see section 08 09
hindlimb digit 5 metatarsal
strong strong
regionalstrong expression: see section 09
fibula
strong strong
regionalstrong expression: see section 01 02 03 04 05 06
tibia
strong strong
regionalstrong expression: see section 01 02 03 04 05 06
femur
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 22 23 24
otic capsule
strong strong
regionalstrong expression: see section 06 07 08 09 16 17
naris
strong strong
regionalstrong expression: see section 13 14 15 16 17 18 19
nasal septum
strong strong
regionalstrong expression: see section 16
viscerocranium
strong strong
regionalExpression in the turbinate bone.
hyoid
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16
meckel's cartilage
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
arytenoid cartilage
strong strong
regionalstrong expression: see section 13 moderate expression: see section 11 12
cricoid cartilage
strong strong
regionalstrong expression: see section 13 moderate expression: see section 11 12
thyroid cartilage
strong strong
regionalstrong expression: see section 09 10 13 14 moderate expression: see section 11 12
axial skeleton
strong strong
regionalstrong expression: see section 05 06 07 09 10 11 12 13 14 15 16 17 18 19 moderate expression: see section 08
basioccipital bone
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
basisphenoid bone
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20
temporal bone petrous part
strong strong
regionalstrong expression: see section 01 02 03 04 05 19 20 21 22 23 24
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 20 21 22 23 24
clavicle
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 17 18 19 20
scapula
strong strong
regionalstrong expression: see section 02 22 23
sternum
strong strong
regionalstrong expression: see section 13 moderate expression: see section 12
pelvic girdle skeleton
strong strong
regionalstrong expression: see section 11 12 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30735
Entity Detected:H2-T22, histocompatibility 2, T region locus 22 ( MGI:95956)
Sequence:sense strand is shown

>T30735
GGAGAGGAAGGCGTGACACCCAAGAAGCAGGCAGAGACAGTCCCCAAGACTCTAGCAAGACTGTTGTGGA
TGATGAGGAGATGGGGGTTTGCTTTTGGAAGATTAAGTCCTGTAAAACTTGTCTAGGCCACTCCCCAGGA
ACTTCAGTTGGCGAGTCTTTACTGTCACCTTGACTGGATTTAGGATCATCTGGGAGATGCCCCTTTGAGT
GGCTGGGCTGTGAGGACAGCAGGCCAGTTCTTGCCACCCTGGACAGAAACACATCTCACCTTTCTGGCTC
AAGGATCTGAACACCTGTCTCTTGCCTACTCGGCTTCTAGTCAGGCATTTTGTCACCTTGTCAAGGGTCC
CAGGGACACAAAGCTCCCTCCTCTCACCCACAGCACTCTGGGTCCTACCCTCAGTGCTTCAGGGACATTT
AATCAGGTCAAATTGGGATCAATGGCTTTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3484613), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 11461. Forward Primer - name:011461_F_IRAV01-03_B15_H2-T22, sequence:GGAGAGGAAGGCGTGACA; Reverse Primer - name:011461_R_SP6_IRAV01-03_B15_H2-T22, sequence:TCAAAGCCATTGATCCCAA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18316 same embryo
 EMAGE:18317 same embryo
 EMAGE:18315 same embryo
 EMAGE:18314 same embryo
 EMAGE:18313 same embryo
 EurExpress:euxassay_012111 same experiment
 MGI:4825309 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS