Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18331

Klhl5 kelch-like 5 (Drosophila) ( MGI:1919028)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18331 EMAGE:18331 EMAGE:18331 EMAGE:18331 EMAGE:18331
"Pseudo-wholemount" of euxassay_012137. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012137_01 euxassay_012137_02 euxassay_012137_03 euxassay_012137_04
EMAGE:18331 EMAGE:18331 EMAGE:18331 EMAGE:18331 EMAGE:18331
euxassay_012137_05 euxassay_012137_06 euxassay_012137_07 euxassay_012137_08 euxassay_012137_09
EMAGE:18331 EMAGE:18331 EMAGE:18331 EMAGE:18331 EMAGE:18331
euxassay_012137_10 euxassay_012137_11 euxassay_012137_12 euxassay_012137_13 euxassay_012137_14
EMAGE:18331 EMAGE:18331 EMAGE:18331 EMAGE:18331 EMAGE:18331
euxassay_012137_15 euxassay_012137_16 euxassay_012137_17 euxassay_012137_18 euxassay_012137_19
EMAGE:18331 EMAGE:18331 EMAGE:18331 EMAGE:18331
euxassay_012137_20 euxassay_012137_21 euxassay_012137_22 euxassay_012137_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18331Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18331_wholemount_strong.wlz
18331_wholemount_moderate.wlz
18331_wholemount_weak.wlz
18331_wholemount_possible.wlz
18331_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18331_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
interdigital region between forelimb digits 1 and 2
moderate moderate
regionalmoderate expression: see section 06
interdigital region between forelimb digits 2 and 3
moderate moderate
regionalmoderate expression: see section 05 06
interdigital region between forelimb digits 3 and 4
moderate moderate
regionalmoderate expression: see section 03 05
interdigital region between forelimb digits 4 and 5
moderate moderate
regionalmoderate expression: see section 01 02
interdigital region between hindlimb digits 1 and 2
strong strong
regionalstrong expression: see section 07 08 moderate expression: see section 09
interdigital region between hindlimb digits 2 and 3
moderate moderate
regionalmoderate expression: see section 09
interdigital region between hindlimb digits 3 and 4
moderate moderate
regionalmoderate expression: see section 09 10
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 14 15 16
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 16 19 20 21 22 23
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
medulla oblongata alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 03 04 05 15
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 01 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 12 13 14
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 03
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 14 15 16 17 18 19
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 04
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 06 07 09 10 11 12
dorsal root ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 moderate expression: see section 02
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 14 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31464
Entity Detected:Klhl5, kelch-like 5 (Drosophila) ( MGI:1919028)
Sequence:sense strand is shown

>T31464
CTGTCGGGGGTTATGACGGACAGACCTACCTGAACATAGTGGAGGCTTACGACCCCCAGACCAACGAATG
GACCCAGGTTGCTCCGCTGTGCCTAGGAAGAGCTGGAGCCTGTGTTGTGACTGTGAAGATATGACATCAT
TCTTTGTCCTCCCTCTCTAACACGGACAGTCCTCCCATGGATTCATTCTTAGTGAATGTGTGGTGCCACA
TTCCTAGGCACAAAGTGCCTCATTCCACAGTGAAGATGTGGAAGCGATGGAGGAGCGGATGCACCAGGAC
GGATGCTTCTTTCTCAGTACGTTCAAGCCACAGCCAGAGCGCTGGGAACACGCCCTCTTGTATACAATAT
GAAGACAAGTGCACCGCGCTAACTGGATTCACATTGTCTAGACTTGTTCCAGTACAAGCATCCAAGCTTC
TAAACGGTTATTTTATAAGTTTGTCATACATGAGCTTCCATACTTTTTATCATTTAATCAAACCGCTATT
TTACTGACATACTAAAGACTATACTAGCTAGCTTTTTCAGGTACAATGACATTATGTATGCTATAGTTGT
GAATTTTATTACTAAAATGGGTTTAACCCAAAAATAAAGAAAACCACGTAAGACATTAAAAATAAGACTG
ACCAAATAAAAACTTGACTGGATCTCTGGGTCCTACTTAAATAGCCATTCCATTACATCTAGATCCATCG
ACTGTGATAGGATGTCACTGAGATTAAAGCTGGATGCTTACATTAAGATATGCAAGTTTGTGTAGAGAAA
ATAAATGCTATATGCTCTCTAATGTTCTCCCACCTAACTAGTATTTAATTATGTGGATTTATTTTCTTTT
ATATTACAAAGGTTTATTTGGTTTTGTCCTTTTGATACTGACACAATTGTTTGGCTGTTCCTGGGTTCTC
TTTGCTGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:5008328), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 25681. Forward Primer - name:025681_F_IRAV59-62_M02_Klhl5, sequence:CTGTCGGGGGTTATGACG; Reverse Primer - name:025681_R_SP6_IRAV59-62_M02_Klhl5, sequence:GGCAGCAAAGAGAACCCA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18334 same embryo
 EMAGE:18336 same embryo
 EMAGE:18332 same embryo
 EMAGE:18333 same embryo
 EMAGE:18335 same embryo
 EurExpress:euxassay_012137 same experiment
 MGI:4825805 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS