Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18358

Sult1c2 sulfotransferase family, cytosolic, 1C, member 2 ( MGI:1916333)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18358 EMAGE:18358 EMAGE:18358 EMAGE:18358 EMAGE:18358
"Pseudo-wholemount" of euxassay_014302. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014302_01 euxassay_014302_02 euxassay_014302_03 euxassay_014302_04
EMAGE:18358 EMAGE:18358 EMAGE:18358 EMAGE:18358 EMAGE:18358
euxassay_014302_05 euxassay_014302_06 euxassay_014302_07 euxassay_014302_08 euxassay_014302_09
EMAGE:18358 EMAGE:18358 EMAGE:18358 EMAGE:18358 EMAGE:18358
euxassay_014302_10 euxassay_014302_11 euxassay_014302_12 euxassay_014302_13 euxassay_014302_14
EMAGE:18358 EMAGE:18358 EMAGE:18358 EMAGE:18358 EMAGE:18358
euxassay_014302_15 euxassay_014302_16 euxassay_014302_17 euxassay_014302_18 euxassay_014302_19
EMAGE:18358 EMAGE:18358 EMAGE:18358 EMAGE:18358 EMAGE:18358
euxassay_014302_20 euxassay_014302_21 euxassay_014302_22 euxassay_014302_23 euxassay_014302_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18358Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18358_wholemount_strong.wlz
18358_wholemount_moderate.wlz
18358_wholemount_weak.wlz
18358_wholemount_possible.wlz
18358_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18358_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 15 16 17 18 19 20 21 22 23 24
radius
moderate moderate
regionalmoderate expression: see section 01 02
ulna
moderate moderate
regionalmoderate expression: see section 01 02
humerus
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 19 20 21 22 23 24
hindlimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 07
hindlimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 07
hindlimb digit 4 phalanx
moderate moderate
regionalmoderate expression: see section 08
fibula
moderate moderate
regionalmoderate expression: see section 04 05
tibia
moderate moderate
regionalmoderate expression: see section 04 05 06
femur
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 21 22 23 24
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
spinal cord
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
otic capsule
moderate moderate
regionalmoderate expression: see section 07 08 09 15 16 17
naris
moderate moderate
regionalmoderate expression: see section 13 14 16
nasal septum
moderate moderate
regionalmoderate expression: see section 14 15
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
hyoid
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
axial skeleton
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
basioccipital bone
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16
temporal bone petrous part
moderate moderate
regionalmoderate expression: see section 02 03 04 05 18 19 20 21 22 23
vault of skull
moderate moderate
regionalmoderate expression: see section 24
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 18 19 20 21
clavicle
moderate moderate
regionalmoderate expression: see section 06 09 16
scapula
moderate moderate
regionalmoderate expression: see section 02 03 04 20 21
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 11 12 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31477
Entity Detected:Sult1c2, sulfotransferase family, cytosolic, 1C, member 2 ( MGI:1916333)
Sequence:sense strand is shown

>T31477
CCTCTGTGCTTGCCAGAAATACGTCCCTCCTTCCTCTATATGTACTTTTGTACTCACTGAACACTGGGCA
GTCCAGCTTTCCAATTACAGACAACTAGAGCTTGAAGGGACTGGACCTTCCTTCCTGAGACATCATGGCC
TTGACCCCAGAACTGAGCAGACAAACCAAACTGAAAGAGGTAGCAGGGATCCCACTGCAGGCTCCAACTG
TGGACAACTGGAGGCAGATTCAGACCTTCGAGGCCAAGCCAGACGACCTCCTCATTTGTACTTACCCTAA
ATCAGGGACAACATGGATTCAAGAAATTGTGGACATGATTGAGCAGAATGGTGATGTAGAGAAGTGCCGG
CGAACCATCATTCAACACCGACACCCTTTTATTGAGTGGGCACGGCCACCCCAACCATCAGGTGTGGTCA
AAGCCAATGAGATGCCAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4223678), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 26533. Forward Primer - name:026533_F_IRAV59-62_P21_Sult1c2, sequence:CCTCTGTGCTTGCCAGAAA; Reverse Primer - name:026533_R_SP6_IRAV59-62_P21_Sult1c2, sequence:GCTGGCATCTCATTGGCT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18357 same embryo
 EMAGE:18361 same embryo
 EMAGE:18359 same embryo
 EMAGE:18360 same embryo
 EurExpress:euxassay_014302 same experiment
 MGI:4828537 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS