Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18396

Plcg2 phospholipase C, gamma 2 ( MGI:97616)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18396 EMAGE:18396 EMAGE:18396 EMAGE:18396 EMAGE:18396
"Pseudo-wholemount" of euxassay_014358. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014358_01 euxassay_014358_02 euxassay_014358_03 euxassay_014358_04
EMAGE:18396 EMAGE:18396 EMAGE:18396 EMAGE:18396 EMAGE:18396
euxassay_014358_05 euxassay_014358_06 euxassay_014358_07 euxassay_014358_08 euxassay_014358_09
EMAGE:18396 EMAGE:18396 EMAGE:18396 EMAGE:18396 EMAGE:18396
euxassay_014358_10 euxassay_014358_11 euxassay_014358_12 euxassay_014358_13 euxassay_014358_14
EMAGE:18396 EMAGE:18396 EMAGE:18396 EMAGE:18396 EMAGE:18396
euxassay_014358_15 euxassay_014358_16 euxassay_014358_17 euxassay_014358_18 euxassay_014358_19
EMAGE:18396 EMAGE:18396 EMAGE:18396 EMAGE:18396
euxassay_014358_20 euxassay_014358_21 euxassay_014358_22 euxassay_014358_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18396Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18396_wholemount_strong.wlz
18396_wholemount_moderate.wlz
18396_wholemount_weak.wlz
18396_wholemount_possible.wlz
18396_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18396_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 01 02 05 06 07 08 09 10 11 12 13 16 17 18 19 20 21 22
radius
moderate moderate
regionalmoderate expression: see section 01 02 03
ulna
moderate moderate
regionalmoderate expression: see section 01 02
humerus
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 20 21 22 23
foot
moderate moderate
regionalmoderate expression: see section 23
hindlimb digit 1 phalanx
moderate moderate
regionalmoderate expression: see section 07
hindlimb digit 2 metatarsal
moderate moderate
regionalmoderate expression: see section 06
hindlimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 06 07 08
hindlimb digit 3 metatarsal
moderate moderate
regionalmoderate expression: see section 06
hindlimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 06 07 08
hindlimb digit 4 phalanx
moderate moderate
regionalmoderate expression: see section 07 08
hindlimb digit 5 phalanx
moderate moderate
regionalmoderate expression: see section 07
fibula
moderate moderate
regionalmoderate expression: see section 01 02 03
tibia
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05
femur
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 17 18 19 20 21 22 23
thymus primordium
weak weak
regionalweak expression: see section 13 14 15
otic capsule
moderate moderate
regionalmoderate expression: see section 07 09 10 16 17
nasal septum
moderate moderate
regionalmoderate expression: see section 14
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
hyoid
moderate moderate
regionalmoderate expression: see section 12 13 14 15
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
axial skeleton
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17
basioccipital bone
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18
temporal bone petrous part
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 18 19 20 21 22 23
vault of skull
moderate moderate
regionalmoderate expression: see section 01
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 18 19 20 21 22 23
scapula
moderate moderate
regionalmoderate expression: see section 03 04 05 21 22
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 08 09 10 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31523
Entity Detected:Plcg2, phospholipase C, gamma 2 ( MGI:97616)
Sequence:sense strand is shown

>T31523
TGACCCGAGTCTACCCCAAGGGACAGAGAGTTGACTCTTCGAACTATGACCCCTTCCGTCTGTGGCTGTG
CGGCTCCCAGATGGTGGCACTCAATTTCCAGACTCCAGACAAATACATGCAGATGAACCACGCGCTGTTT
TCGCTCAATGGGCGAACAGGCTACGTCCTGCAGCCTGAGAGCATGCGCTCTGAGAAGTATGATCCGATGC
CCCTGGAGTCCCAGAGGAAGATCCTGATGACACTCACTGTCAAGGTTCTTGGTGCACGCCACCTCCCTAA
ACTAGGGCGGAGTATTGCCTGTCCTTTTGTGGAGGTGGAAATCTGCGGGGCTGAGTATGACAGCAACAAA
TTCAAGACGACGGTTGTGAATGACAATGGCCTCAGCCCTGTCTGGGCTCCAACTCAGGAGAAGGTGACAT
TTGAGATCTATGATCCAAACCTTGCCTTCCTACGCTTTGTGGTCTACGAAGAAGACATGTTCAGTGATCC
CAACTTCCTGGCTCATGCCACGTACCCCATTAAAGGCATCAAATCCGGGTTTAGATCAGTCCCTCTGAAG
AATGGGTACAGTGAAGACATCGAGCTGGCATCCCTCCTGGTTTTCTGTGAGATGAGGCCAGTCCTGGAGA
GTGAAGAGGAACTCTATTCCTCCTGTCGCCAACTGCGGAGGCGGCAAGAAGAGCTCAACAACCAGCTCTT
CCTTTACGACACGCACCAGAACCTGCGCGGAGCCAACCGTGATGCCCTGGTGAAGGAGTTCAATGTTAAC
GAGAATCAGCTGCAGCTGTACCAGGAGAAGTGCAACCGGAGGCTGAGAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:5354925), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 31849. Forward Primer - name:031849_F_IRAV67-70_B21_Plcg2, sequence:TGACCCGAGTCTACCCCA; Reverse Primer - name:031849_R_SP6_IRAV67-70_B21_Plcg2, sequence:TCTCTCAGCCTCCGGTTG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18397 same embryo
 EMAGE:18400 same embryo
 EMAGE:18399 same embryo
 EMAGE:18398 same embryo
 EurExpress:euxassay_014358 same experiment
 MGI:4827255 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS